Description :
From Genome Similarity Track
Location :
scaffold_38:301195- 316606
Transcript NameFunction/comments
g12730.t1 acyltransferase, putative
g12731.t1 hypothetical protein PHYSODRAFT_551932
g12732.t1 glucokinase, putative
g12733.t1 RNA polymerase II-associated factor 1
g12734.t1 conserved hypothetical protein
g12735.t1 hypothetical protein PHYSODRAFT_473613
g12736.t1 hypothetical protein PHYSODRAFT_476945
g12737.t1 hypothetical protein PHYSODRAFT_468947

Sequence
15411 bases(100 bases per row)
AACAACACAGGGGAGACGGTTGCCGATGTTGAAGTTCTTTCGATAAGTAAGGACGGCCCATCATTGACTGAAGAGAAGGTGCCTTGTCCTCATGAACCGG
AGCCTTTGGACGCTACACCAAGAACCGACAAAACTCCGCCAAGTGATGGAGGCAAAATCTATGGAGAAGCAGTCTCTGAAATGGTGCAAAAACTGTGGAG
GGTATGCAAAGAAGATTGCGAGGTGAGAATCCGAGCGAAAATTGATGAGAAGCAACAACAAGTGGCCGCGCGAGTGGAAGCCGTGCAAAGCTTGCGGACT
CGGGTAATTCGGGCTGTTATGGAAGTGTAAGTTTTACTGTTACCATGCTAAATATTTAAAGCAAAACTGACCCAACGAAATGCTACAGGGATGGTGCTGA
AGGTTCGAGTCTCAAATCTTCACCTGCTGGTGACAGGTACGAACGAAATCGATTGCCAAATTGGTCTTTTCGTTCTCATGGGTGAACTCAAGCAAGTTTG
GTCTGTACTTCGCAGAAATAATGTGCTTCTATACGAGGCCTCTTGCATGGTGAATGGCATTCCTGTTACGCTTCATGTGACTTATGGGTACGGCTTGCAC
ACTGTTCAAATGATGGGTAGTATCCCGATCAAAATTCCGGTGAGCTTACGGCAGGGCTATGTATGATGTTTTGGTGCTTCGGTATAGCAACGTCATTTAT
CGGACCATGGTGCCTGTATTTGCGCACACAACGGTAGTTCCGTTTGAAGATGTTGTAAATGTTGTCCAGACTACTTCGTTTGGCATTCAGGTGGTTTCTG
TGGAGCTGGATTCAGCAAAACATACGAAGGGGGTCACAATTGCGATGGGCCTTGAAGTCGACCTGCTGTATCAACTTCTCCATGAGGTGAGCTGACGTAT
CTGTAAATAATTGATTGATTTCCGCCGCTCGCTCACACTGCGTGTCTTGCAGCTTTTCTCCATGCATCAACGCGAGATCAGGGCAAACATTGCAGCCTTG
CCGCCTCTCCAGCAACAGGAGACCGAGATAAACCCGACCGAGCTGAGGAACATTCTGGGCTCTGAAGAGGAGGAGACGAAGGAGGACGAGGGGTCTCTAG
CAACTGAATCAACAGCCTTGGCCGCCGCTGCTGCAGCCTCTGCTGACAGTACCCCATCGGCCTAAGAACACTTGTGAATGAGTAATCAGTAGCGACAGCA
AGTATCTTGCCACAAACATGCATCTCAAGTGACTTTTTCGCCAAATACATAATTTATTTCAAATATTGCGGAGCTGACTCGCAACTTGCTGGGAAGCGGT
AGCTTGCACAAATACTTGCTCGGACTCCCAGCTTAAAGGCGGTGCTGACGGTTGGTACTCATGAGCGAGAGGAATGGGATCAATCGTCGGCAGCGGGTCG
TAGTTTGTGACCCCCAGCAACGGCTCTTCCATGTCGCTCTCCATCATCGTAGCGCTCGGAACGCGCGCCATCTGATGGTGCCGCTGCTTCCGGAGGCAGC
AACGGCGGTACAGGAAGCAGAAGAGGTAGGAGCTGCACAAGAAGACGGCCACGAAGCACACGAGCATAGCATCCGCCCACTGCATCCGCTGGAGCCGGGC
GCTCTGCTGCAGCGAGGAAGGCGCGTCCGTGTCGATCCACATCTTGAAGCACGAATTGGCAATTGAGTTTTCTCGCACAAATTTTGGGTGGGACCAAAAC
TTGGCAAAACTCAAGTCGCCGCGGACAAGTACCATAAGTCATATTCGAGCTGCAACGTACCTTGGCATCCAAATGATCAATGGTTACGAGTGCTTGGGTG
GTGCAAATGTGACGGGTTGCGGCACGATGGACCCTCTAATGCGCCTTACATATTACGGATCGTGATGCAATTGACCAATGCACGATAAACATGTGCAAAT
TCACTTCATTAAAGCGCACAGCAGACAGAATTACATCCATGGTCTTGTCACTTAGCCACTGGGCTGCCCACCACCTGGTCCATGAGTGAATTCTCGATAA
GCTCCTGGCTGGCCGTGATGCTGTTGGCAGCAGCGCCCATCATGAACTTGGTCATGGCTCCCATGACGGGGGAGTCTTTTTCTGGTTGCTCTTGTCCGTG
CTCGAGCGACACCAACGAGCACATCTGAAGTAGACACCGCGGGCCGACGGACTGAGAAGGAGGCACTGGTGAACGCTTGGCGACAGCATAGCATTGGTGG
CGGTGTGTCAGCCCTGCGAAAGGTTCGTCCACCACTTCCAGAGGAGTTTTGATCGAGATAAACACCACCACAACACGGTCCTCCTCCACGTAGCGGCGAA
GAACTTGCTTGACACGGAACATAGCGTGCGTCGAGCCAACGTACATCTCCTTCGCGAAGTTCTCGACGATTGTATCAGATTCGTCCATGACCTACAGTGC
ACATACAAGTTCCAGGTAAGCAACGAAACTGATGCTGCTAGCAGCGACACTGTACCTTTGCAGTCTTCTCGTACACCTTGCCTCTGTGTTTGTCAGCGCC
CTTGAAGTGGTCCCATACCGCCTTTGCAGTGGTGTCCATATCAAAAGGAAGCACTTTGTTGGAGAAAACGTCCAAATAAATGCCATCGTCTCCATCACGC
ATTTGGGTGTCTTTATATGTGACCTCCATCGAGTTCAAGCCATTTGTGCAGAATACAGCATCCATCTCGCGGTATGCACCCTCCAAAATCACAAGCATAT
CTTCAAAGTCGCCAAGATCCGACTGGTAGTTCACCATACGACCTACCGCGAAATCGGTCGTGTCCGGCGACACAGTGCGAGAACACTCCATAAGCTGCAC
AATCAGCACGACTTGACGTAAGAATCCAAAACAACTACCAAATACAAACAATAGCAGCCGCCATTACCTGATTCTTTGCTCGCTTGAGTAGCAGCATCTG
CATGCTCTTGGCAGCTTTGAGTTGGCTCTCCAGCACGAGTTTCAGCCTCGCATTCTCGATCTCTGCTTTCTCCCTGCGCTTGCGTTGCTGTTGTGCCACA
GGCTTCCACACCGATTGTTCTGCAACGGACGAGGGCACCAGGGCGCCATCATGGCCCGCACTTGCATCTTCGTGCCCATCCTGCTTGATCAGCTTCACGG
ACGTTCTGTGCTGCTGCAGAGTGTCCAACTCGGCCTCCAATTGGGCCACTTTCTCCTTCAAATACGCCACCTCAATGCGGCGTTCGTTCCTGGCCCGATT
CGAGTCGCCAGTCACCCAACTCTTGCGCAGCAGCTTCTTGGCCGTCGATCGCCTCGGCGCTCGCGTGCGCTTGGGCTTCTCGCGCTCGATACGACGTGGC
GACCCGTCCTCGTCAGTCGTTGTGTGGTGGTTCTCGCTGTTCGACGCCGGTGACGACATTGCGTTGGGGTTCTGAGGCGACGAAGCAACCGACGAGGGCG
AACCCGTGGAGCTCGGGAAGCCCAACGCCCACTCCATCTCCTGCTTGTTCAGCACCTCTAGGGGTTGGATGGGAATGGGCGCGTCGCCGTTGCCGTCCGC
GAACTCGTCCACGAAGGACAGTGCAGCTTCGAAGGCCGCCATCTCGTCGTCCGCCAGGAACGCCATGGCATGTGCTTCTTTGTCGACGCTGTTCAATACT
GAAACATGAATTGATTGCTGAATTCCGCTGGTGCAGGTTTTCGGTCAATGGCAGGCTGTCAATGATCTGGATATCTACCAATGAGTGCATTGTTGGACCT
AATTGTTGAAAAAGCAACATATCCGCACTGAACCAGGACGCGGCATGGATCGGAGAATCTGGTTTGAAAGTGGACGTGAAGGAAAAGTATTAGTACGCGC
GTAGGAAGCCTACCGTCCAGACGGTTGAAAGCCGCAGGTCGTCGTGGGTTTGGCCGCCGCAGTGCTGCACAAACTGCTGACACAAGCACGCACTAGCAGA
AACCTGCATGCTGCAGCATGCTGTATTGGTTGCACTGCATAATGATGCGACGAGCTCTCCGCGCAGCATTCTGCTACGCACTGCACTGCGTAGGCTGCAT
TACTATACGCAATATTCAATTGATTGTGTGCTGATAGTATAATGGGAACGCCTGAGGTTGGAGGATCTGAGGGCTGTGAGGGTGGGCTGGCGTCGTCCAC
TCCGAAGGACAAGTTAGGCAAGCCGGTGGGTATAATGAAGATATGTATTAAAATATTAAGAAGGCTGTACAGGTCACAGTGTGCAATGACGCCGACGCCG
CTGTCTTGGCGGAGTAGCCATCACGTGACTACCTAGACCCATTGAAAAAGCAAGCGCTGGATATGGTTCGGGTATCATTGGCGCCGTCGCCGTCTGCCAG
TCAGCGCTAGACAAGTGGAGATGGAGACATGAGCGTGGAAATGATAGATGAGTCTTTGGTTGATACATGAGTTTGTGGTTGTCGAGCAGAGTGGAAATGT
ACATGTCTTTCAAACTCGTTGACAACGGGAGACCGTTGCACTTGCGGTGGGCTTGGCCAATCAGGGTCCGGCCATGTGGTTTTGCCAAGCAAGCAAGTTC
AGAGGCGCCTCATAATTCAAGCGGCGGTACGTCGAGCGAGTGCGTCGAGTGTTTCCAGACCATAGCAGCATCGGACCCAATGACGGCAGCTGTCATGTTC
GCGGGCGTGGACATCGGGGGAACGGGCGTGAAGGTGGGCGTCGTCACGTCCGAGGGCTGTGTAGTGGCGCGCGAGCAGAAGAAGTACCACCCGGAGAAGC
ACGAGCCGCAGGACGTCGTGGATCTTGCCGTCTCCGTGCTGCATCAAGTGCTCAAGACGGTGCGTGCGTCGAAGTTGATGGTAATTAGAGTGAGGTGTCT
CACCAGTCGTCTACCTCATGCTGGCAGACGCGATTGGGATTGGGGGACCTGGAGGCGGTGGGCGTCGGCTGCCCCGGCGTCCTGGAAGCTGGGGGCGTCA
TCCACGCAGCTGCCAACTTCCCGTTCTGGTTGGATGTGCCGCTCCAGCAATTGTTCACCGACACCCTTGGCAGACCGGTTAGTGGGGGGTGTTTGGGTCT
GTGGCTTGAGGAATGTTATGGTGCTGACCGAAAGTGTAGGTTACTGTGTGCAACGACGCGGATGCTGCCATTTTGGCGGAGCAGTGGGTCGGCACAGCCA
AGGGTGGCATCAAGGATTTTATCATGCTCAGTGCGTGAATGTCGTGTGGCTTTCTTGGAGAAGGTTACGATAGGCCTGTATTGACCGGCTGATTTGGGTG
TAGCACTTGGTACGGGTGTAGGATTCGGTGTCGTTGCGAATGGCCAGCTTGTGCGCGGTGGAAGCAATGCCATTGAAGGGGGTCACATGGTGCGAAGCTT
GCTAGTATACGGGTTAAATTGACCGCTTGTCGTAGCTGAACGTGTGCGCTTGTCCTTGTAGATTGTGGAGCGCAATGGACGACCGTGTGGTTGCTCTCAA
AGAGGTTGTCTTGAAGCTTACAGCTCGGCGGGCGCATTGATGTCGCAGGCTCAAGAGCACTTGCGCGCTGGTATGATGCTGGAGCTGTGTGTTGATTATA
GGAAGTGAATACCTAACGATTCTGTCCACTGTGTTTGAATTATGTAGGAAGGGATTCGAGTCTCGCCAAATATTCGGAGGAAGATATTAACGTTGAATTC
GTCTTCAAGCATGCCGCCGAAGGCGACGAGCTCTGCAAGCATCTGATTGAAGAAGTAAAGTATGGCTGTGGCACCGCCTTATGGTTTGACTTACTAAGTG
ATGCGAAACTAATTGTACAGGCTGCCGACTACTTGGGTTTTGCCTGCGTGACCTTCTGCCGAATGTTAGACCCGGAGGTAAGGATGTTCAGAGCCATGGA
GACAGTACTGCAGAGATAACCCTGTTTCCTTGATTGTGGCAGATTATTGTTCTGTCAGGGGGAATTGCCGAGGCTGGAGAGACCTATGTTGAGCAAATTC
GTCGTGCCTACGCGAAGCACACGTGGACTAAATTCCCCAACCCGGTACGCTTGGGCTTCTCGTTCCAATATCTGTTTCGATGATGTCTAACTCGTGTTTT
ATGTTATGTGTATAGGTTCGTATTGAAAAAGCGAGCGCGGGGTATGATTCGGGCATCATTGGTGCCGTTGCGGTATGCAAAAATCAACGCAAATGGCAGT
GAAGCTTCGTACGGTGTCGTATGCAGGCAGATGAGTAAGAAGTCCCAGAAGATTCCAGCTTCAGATATCGATGATAGTTGAATGAAGTCTCTGTTTGATG
TAATGCTGGGTTTATTTGATGATCGCGGAGCGGCAAGAAACAAATCACTTTCAGGTAGTGTGTATCGAAGGAGATGCCGCATTTCCTATCTGTCCTGAAG
GAGCAGCTAACAATTGCCAATCAAGCTAGTCACTGTCGCTGTCGCTGATGACGGGGCTGGCATTACCGTCGTTGTGTAGAACGGGGCTATCACTGCCATC
GTTTTTGCCGCCAGCGGGGCTGTTCGAGATCTCCGGTGAGCTTTCAGGGGGAGGTGTGTTTGCCTTGTTTTCCTCGTCAACAGAAACAGGCGATGATCGC
TTCTCTCCTGCCCGTCGGCGCTTGAACTCGCGCACACTCTCATCGTCATCAAGCTGGTCGTCATAGACTCCTCCGCACTCGAATAGGTCCTGGGTACGAC
GGTCTGTTTCGACTTCTGAGTAATCCCGACGGTAGACAACAGCTCCGTGGCGACGTTTTTCCTCTCCAGTCATCTGCATACAGGAAAGCAGGTAATCGTC
AGAACAGCAGCGACGCGAGCCCCAAGAGCATGAACGCACATACCTTCGTCTTCCTCAGCTGGATGCGGTTCAGAACGTCACTGTATGTGAAATGGTCGGA
CTCCGGGTCTAGCATGAACATAACATGTTGTGACTCCCTCTGAGGCAGCGAACACCAATAAACAGAAATAAATCAAAGTGAGCACAACAATTTCAGCTGA
AACAGAATCAAAATCGCCAACGTACGCTATCAAGCGACTCCACCGCCATAAGATACTCGCGGAGGTACGAGAATTTCTCGCGATCGCTACTGTCCTGTGG
TAGAAGAAACAATTCACCCATTAGCTTGTGCCGCGGTGCTTTAGTGCATACATAACAGGGGTGTACCTCTTCTTCTGCCGATCCGTTGGGCAGCAGGATA
GAGCCCTGAATAAGCTCCTTGCCAGCTTGGGTCTTCTTGTTTACGCCGCACAGCAGTGCACGATCCTCGCGGCTTGTGATTCCCTTGCTCTTGACATCTT
CGGAAGGAAGAATATCGTACGACTGCAAGTCCACAGAAATTAGTATCCTGTCAGCTTGTGTCATAACGCATACCGAAATTCCGCTGCGAGCAGACGTACC
AGAATTGCATACTTGTTGGCAGACAAGAGCTGATCGGGGAAGACATCCCACACCTTGGCGATTTTTTTCCTTTTGCTGTGCGGGTGCACCAACAACTTTG
GATCGTTAATGTCGCGGAAGGACGCTTCGGCACGGTCCTCTAACGTCACGGACACAACCTCGGCCAGCGCATTCTCCGTGCCCTCACGCAGTGCACTCTG
AATTTCTGCCTCGCTCTTGAACTTGTGCACGGAATCGTACAGATCGTTGCCCATGTACTCCGTGCGTCGCAGCCAGGAGACTGTGGGGCGCACCTTAGAT
CGGCCCTTGGTGCCCATATGGTCCTCCTTCATCATCAGCGCCTGCTCATCGCCAACCTCCAGCGGCTCGGGGTCCGTCGGGGCTGCAAAAATCCATCCGC
GACATTTTAGCACAAAATTCTACATCCTAATCCCCCAGATAAGAGTTCTACCTTCATATTTGGCCGGATCGATGAGGTCGATGGTCAGTCCGAGGTTCGG
CTCCTCGTGGATCTCGTACGTGTAGTCCATCTCGAGTGTGTTGGGCTTGTACTTGATGAGTCTGTGCACATAAACCACCACCACATCATCAGCTTCTCCA
CCTTTCTCCCATTCTGCAGCTCGCCACTGTCGCACCGTTCCGGCTCGTGCGGGTATTTGACAAACTTGGTGTCAAACGGGATGTCCGGCAGCGAGTTGCG
GAACTCGAGGCTGGCCAAGAACTCCGACTGCTTGCCCAGCAACGCGCGTCGCTTGGCTTGCGCGTGGCTCTCCAGGATCATGCGTGTGTGGTCGCGCCGC
GCTTTGAGTTTGTCCTCCTTGTACTTGGCCACCTTCTTGCGCTCCAGCTCATAACGCGCACGTTCCTCGGGTGTGGCATTGGCACCGGGGGGCGCCCGCC
TTTTCCGCGCCTCGTCCTCCTCGCGACTGCGGCCGTTGCTTTTGCTAGCCGCCGCGCCGTTGGCCTCCGTCGCTGTCTTCACCTCCGCCATCGCTCGAAG
CTCTTTTTGCTCACTCCCCCTAAACCGAGAAATGTGGTGGAGTCTAATTTACGTGGTGCACATCATCATATTTTTGTCACTTCAAACGGCGTTTCGCGCA
ACAAATGGGCTGTAGCCGACTCGCCTATTAGCCATGAAGCAGCTGCTGATCCTGGTGGCGCAGCACCCGCTCAAGGTCGGGTCCGTGGTGCTGCTGCTCA
GCGCCTTCTACAGCTTCGCGCGCGTCCTGGTACTACAGTACGTTGTGGGCTCCGTCCAGGACGCCATCGTGCGCTACCCGAAGAACTTCCCGCACGCGTT
CTTCCTCCCGCTTTTCCACGTGTCGCTGGCGGTGGCTGCTGCTGCTGCATTGTATCAGGACTATTGCTACAATCGCTTCTGGAGCTCCTCCACACCCACG
CAGCTCTGGAAGCACGTGCTGCCCCTGCCGCTCACACTGCACCCCGGCAAGTGGAGTCGGTTGGTTGGCATCCCTTTGTACGCGTTCGGCATTGCAGTTT
TGGAGGCTGTGCTTGTGTTCAGGGACCCTACCATAGAGAGTGTGGCCAAAATGGTCACTAGAGTTTTGTTGCAGCCGCCTCGAGAGGAGGGGCAGGTACT
CATGCCAAAACACGTTGCAGGCGTGCTTTTTCAGGATCAAGCGGAGGTGGCCTGGAAAATACTTACAGGAGGTGCAGCAGCTCAGAAGTCATCGACGCGT
ACGTTTTCGTACGTACGACTGCTCGTTGAGATCTTGTTGGCTGCGGCAGTTTGTGTAAGCTTCGCTCTTGCGCGGTTCTTTCGAGAGCCTCAACACGGTA
CGTTGCCGCTGCTATTGCTGGGTTAGTTTCTGTATAACTTACGCCTTGCGTAAATACTTGTTGCATTGGAGTGATTAGATGGGGATGAACTGCGCGAAGC
TGCGAGAAACAATGACATTCTAGGAGTGAAGCTACTTCTTGCTCGGGGGATGGACCCGGATGCTTGCTCTGGTGATGGCACGACGGCATTGCACGTCTGT
GGGCAGCAAGCAATTGACAGGGCCGCGCAGGTTCTTCTTGAGCACGGGGCAGACGCGAACGTAGCTGATCGACTTGGATTTACGCCACTACATTGGGCTG
TACAAATGCGACGAGAAGAAGTGTCGACTTCAAGCCGTTTGGCGACGATTCGAATACTGCTGCACCATTGCGCTGACCCACGCAAACCCGACTCAAACGG
CACAACGCCGTTAGTAATTGCATCACGAAAGGAGAACGAAGCATCGTTGGGAGTGCTAAAGGAGTTCTTGCCTGAAGGTGAAACTGGTGGAGAGGTAGAA
ACCACCGAAACGATAGACAACGCCAGCGTGGACTTGGCAATTCCGAATAATTAGCAAAATTACCACTCATCGACTACTAAATCCCGTGACGTCCATCTCT
ATTACCTACCGTTGGCACCACAATCATAAGGTCTGCGTTAGTTCAATGTAACCCAAACGCACGATGCCAAAGCACGTACCATTGACAAAATCCTCTCTAG
CTCTGCCTTAGAAGGATAGAGTGGTAGATCCAGCCTGAACCAGCAAGGCAGTGGTCAACAAAGCGGCTTGCAGAAACACGGTTCAAAATATGCACTCACC
TGTTCAAGCACGTACTTGCATGCGGTAGTACGGTGTACACGGTTGAAATATCCTTCCCAAGCTGGATTGTGAAAAGTTGGATCTCGCCATCCATACCAGT
CAGACCCTGTATATTGAAGGTCAGAACCAAATTCACTTAACGCGTAGTGAAGCCGAAAAATATACCTTAAAGCCTTCGACAGGAACGCCGCTGGAACCAG
TGACGTACTGCAGCAATCTTCCGCGTTGATCTTGCGTGAACGACTCTAGAATTTCCCAAAACCAGGCAACCAATTCAAACTCGTGACTACTTTGTTCGTA
GAATCGAATATCTGTGTGCTGTCTCCAGTCATTGACATCGATTTGAGGTAATCCAGAGAAGAGTATGTCAAGTTCCTTGAAATCAAATACGTGAAGAACT
GAATCGCTGATGACACTGCGCAGACCCTCCATGATGCTCGAAATTTCCGCTCGAACACTGTCAAACAGATAGTACTGTGCCACTTTTGCAACGTAAAGCT
GTTTGTTTCCATCGTGAAGAATGACATCGGCGCCATTTGGAATAAGTTCTGCGCCATCCACCGTGAAGTTCAAGCCGAGAGCATTTGTGTTATCGTTTTC
GAGGATCCACATCATACTGGAATGCACCGTTTCATCGAGCAGATATAGGTCTGAGAGCTTGAGTGGCACGCCGAGAATGTGCTTCAGCAAAGGGACGGAA
AGCCGCACGTTTAGAAGTAGGCCTTCAAGCAAAGCCTTCCCCAATAGCTTTCCGAAGAAGACGTACATCTGTTATTATGAGCATCAACCACAGTTAAAAC
AATTTGTGATGAGCAAAGAGGCAATGCTTTGGACATACCTGCAGCTGCTTCGTGCATTTCCCCGTCGCAGTTCGATTAATCCAGTATCCCTGGTGCGCTG
CTGAGCTGGTTAGTGTGAACAGCCCCAGAGATTCCGCAAAAAGCTGGCTGCAAACAAGATGCAGCCACTCCCGCAAAATGCCACCACCATCGACGCCAAC
CTCATCCATAAAATCGACGCGTAGTCGGCGATGTAGAGTTGCATCCGGTGCAGACATAAAGAGAGTCATTGACTGCTTCAACACCCTGTCACGATGAATG
CCTGCAGCTTTCGTCAGTTGAGCAACCTGAAAATCACAGCCACAGCTAACGTACGTATAGTATGGTAGCCATCGACAATGGACGAGCAGAGCTTGAGCGA
ATACTGGTAGAACCACTGTGCTTTCTCGGAAAATGGCAAGGTCGATACTCGCTAAGAGAACCGCGCACAAAAACATTAGACAAGAGTGATAAGGCTTACC
CGACCGACTGGCTTACCATGATCGTTTTGGAGTATGGTCGTGATGAAGTTGAAAATTCCTCGGCTAAGCGCCAGCGCACAGTTCGGCTTCCCGAGTGTGA
GTCATCTCGCACGAATGCAGTTCCTGGGGTGAGCCAAGAAAGTTGTTTCCCACTGCTGTCCGAAAAGATGACAGAGGAAACAGACATCCTCGAGGACCCA
GGCACCTGTGGAGGGTGTTGTATTTCCCATTCCTGAAAGTCACGCTCTCTAATAATGACGCTGCATAAAGCCTTACTCACTTGGAGAGCTTCAAAAGGAA
CGTTTACCTGTAAGACCCAGAGTGCATAACATTAGCTATACAGATCATTATCGGATCCGAAACTTTTCACCCCTTACCCAGCGCACATGTTGCCCTCCAA
TACAGCGCTTCCACTGATGCCGTTCGCGTGCAATTAACTGACGGTCCGTCAAATCTTCACTAGGAAGAGCGTTCAGACCTCGAATCCAGGCAGCACGAGG
AGAGGACATGAGGAGATAGTTTGAGGCCGAACGCTGGCTGATTTCACCTTGGGGAGCGCTCAGTATGGAAGCACTCGCATCTTCCTGTCGACTTCTGATC
ATCTTTAGCTCTGCAATCCACGAATCCAGCACATCAGATCACAGATAAACCATGAAAAACAAATTCCAGCTTTTTCAAACCTTCAGCCGTAGTACCGCAC
AACACGCAGTCGGTCTGCGAAAACTCGTTTGTGTGGTAGCAGATCTCGCATCTCCATCCAGCATTTCTACAAAAATGCCACGACACCGGAAAGATATAAA
TCCCCGATCTCACTTGATCCCCAACGTTCAAAAAGACTCACGATCGTTCGATGAAGGCGCGGTGGCGCGACCGCCGGCTCGAGCTCGTGCAGCACTCCTT
ACAGGCTTTCCACGTCAAGCATAGTGTGACAAGCACGAGGCCCACGCCAATGCTGACGCCGATGATCACCGTCTTCGAGCCGCTGCTTCCGTCGGAGCTG
TCCTCATCATCGTTGTAGCCGTAGCTCCCGTCTGTCCAACATGAGTCCATGCCATCAGCACCAATCTCACCTCACTAGCTCTCACATTGCACCGTACAGT
GGTAGTCGTAGTCACCGGTCGTGTTCGAGTAGGTGCCGTCCAGAATGGGCATCAAGCCGCGCAAATCCACGCTCTCCTCATGTTGCGTGGCTCTCCTCAG
TTGGGGCTCGGCGCCTGCGTCCATTGCAGCTGCTGCACCATTCAGTAAACCCAGCCAGGTGGCGACAATGACGAGCGACGCCAAGGTCCACAGTCGCCTC
GCCATCGCTGCGACTGCAGCAACGTCTGTTGCTCCTCTTCGGCGACTCGTTCCGGCCGCTCTCCGACCGCGTGTCAAGCTTCCTGCGGCGTCCTCTGCTG
GTGCATCGACGACCTGCTTGCGCATGTACAGTCGACTTGCTGATTGCAGAAATGGAGTGACGAGCTTTCGGCCAATCGCGTTTCATACAAAAATCAAGTG
ATAACGATTCGGATTTTCACGGAACTGTAAGTCCGCCGCTCACACGTTGGACTCAGACAAATCCCGGCGGCAACCGTATCGACACCAAGCATCTCTACAC
AACACCAAAATAATATTTACAGCTTTTTATTCCTCTTTGTGACCTCGCAATGGGCCTCGCCTCCTCCTTCAGAGTCGCCGCCGTGCTGGTCGAACTGCGT
TTATAATTTGAACAGACGAACGCCGTCGGCCGTCGGGATGTTGCTGCCTCCGCTGCGGCGGCCCGGCAACGGCCCACAGCGTCCGTCTCATTCACTCACT
CTCACATACATGGAAGCTCCATCTCCTCTTCTCCCTTGGTAGCCACTGGCTCGACGAATTCATTCTTCACACGAGCGCGGCAGCATCCGACCTTCTCTCC
CGTGTTGCAGTCTCTCCTTCGGTCGGAGAGTGCATTGGGGCTGGGCAGCCTAGTAGGCCTGGCAGAACTTGCGCAAGCACCCCATCGTGGAAAGCACTGG
GTCCGAGCGCACGATGTCGATGAACGTCTGCAGGCGGGCGCGGCGGGCGTTGAGCACATGGTCCGTGAGCTCAGGCTGCACGAAAAGCACAGCGCCGCTC
GACACGTGCGGCACTTTCACTCCGCGCGACGCCTTTTTCGCCTTGACCTCCTTCTTCAGCTCGCGCTCGAGTTGCTTGAACTCGTCAAAGGTTGCAGTCA
CGTCCCACATGACCACGGGGTTCATGTGCTTCTCCTGGCCGGCCGACTGGGCACCGCAGTCCACGCGCATGACGTAGACGTCGCGGGGTTTGCGCTTGCC
GGGGACCGCCTGCACGAACGCCTTGCCCACACGAATGTTCGCTTCGCCTAGGTTCATGTCGACGCGGCGGCGCATGTCACCGGGCACCACATTGACCAGG
AGGCGATTCTTGTTCAGGTGCGCCAGCACACGACGTCGGGCAGCCGGGGCCTGCCGCTCCTTTCTCTTGGAAGCGGCCGCATCGTCTGTCTTGTCGACAT
GGGTGGACTTGGACGCAATAAACCCGCCGTCAACGCGGAGCAATGGGAGCGTGGAGGCTGTAGCAGTCACCGGCTTGGCGATGTAGTAGTTTTGAACGGA
GGCCGCGTTGCGTGAGGCATTCATGGACAGCATGGCGCAGCCCATGAAGGTGTAAAAGCTGATGAGCCCGAACGCCGCCCCCTGCACCAGGAGCGTGAGC
ACGAACGCGAGGACGTTCCAGGCCAGTACGCAGGCGACATAGGTGGCGAGCAAGAGCGACGCGGCCGAGCTGAGGGTGACGTCGAGGTGCACGAGCGAGT
CGTAGGCGCTCGTGAGCACGGCGAGGCGGACGCCCGGCAGGTTGAGCACGATCGTGGGCTTGGCATTGTCGGAGCTCACGGCGCGGGCGCGGGTCTTCAT
GCTGTCTGTTGGTGGCATGGTGGCCTCGAGGGTCTTCGCAATGGCGCGAAGGAGTCGTACGTTCAGCGCTCGCAACTGAGCCCGAACGTTGGCGCTGGCA
GGCAAATGTGGGTCACAGCAGGAGGCTCGGAACGCTGCTGTGGCGTGGGATTCTTCTGCGTCTGGAGCTGCGCGAACTGGCTGCGTCTCCTTCCGCCCTG
TTGATGGCTCTCCTGGGCACTGGCCTGTTTTTTTCGGAGTGAGCGCGGGGAAAGACGGCGGCTCTGCCCTGCAATGTGCACAAGCCATGTTGATGAGCTT
GTCGATGAGGAGCGGGTTGCGAGTCACTCTGAAACTGGCTTCAAGTTCAACCGCTCCGCTTCGCTTTTGATGTGAGACCTTGGTAGCGAGAGGAAGAGTG
AGGGCTTCACGGAGCTTTATGTTGGTGCTGCCAGCAGTACACATGGGCTGCGCGCTGATTAGGCCACTGCTGTGAACCTCGCACGCAACAGCATAATGCC
CGACCACCACATGGATTCTCCATCCCTCCACATGGTGTCTGCAAACCTGGCCATGCTGTTGCTCTGCTACGTTGTCAGATAGTCCACACCTGCAAACCAA
CACTCGAGTACATTCACATGAAACATTTCCATTTCCCCTTGACCTTCCTACTTGAGCCGCTGCGCCGTGGCGGCCAGGAGCTGGCTGGTGAACTCCATGT
CGGCAGTGCGGACCGTCAGGTCCACGAAGCCGCCGCTGCGGATCTTCACGTGGAGCAATCCTACGTGCTCCGAGTTCACGAGACGGCAGGCAGCAATCGC
TTCGTTGGCTGGAGAGTAAGCAAAGTGACAATGTTAGAGCTCGGCCACACAACGCAGAATAAAAGAGTTATGCGACGTACTGGTTGGGATGGCTTCGACG
GTGTGCACGTTGAACTGGTGCATGCGGCCCATGAAATCCTCGAGCGTGCGGATGCCGCTCGGGTTCACCTTGGTCTTCTGCTCGCACGGGCACGCGCCCC
AACGGCCGCCGAAGTCCTGCGTGGTGATCTGCCACGGCTCCAGCTGCCGTCCATTGTACTGGAAAACGCCGGTGCTGCTGCTACTGCCACCCAGAATATC
CAAACCATTGGCAGGGCTCTTGCCAAGCTCAACAGCAGCTTCACATACAAACAAAAGCAAACCAAGCCATTTAGCAACCATCCACCATCCTGATGCATCA
GAAACCTTTCCTAACTTACCATTCATGCTTGAGCCGAGTCCAGACATGTCGAACGGATCCAAAGAAGCAGAGGGGGCCGGCGAGCTCGCCTCGCGGGCCG
GTGCTGGCGCT