Description :
From Genome Similarity Track
Location :
Scaffold_80:30119- 31737
Sequence
1618 bases(100 bases per row)
GTCGATTCCGAGTCGGTATTGAAAGTCGAATTTATCCACGGACTCATGCCGGCTTCGCCGACGGCACGTAGTGAGATTGCATAAGCCGTTCCGGCGCCGA
GTCCACCAACAGTAAGTGCTTCGCAGTTGTATGTCGACTCGCCTCGCCGGTCGCAAGCATGTGACCGCTCCAATATGGTCGTTCCCGAACCAGCGGTGGT
GACAAGAGCATCGATGCTCAAGGACCCGCCTCCGGCCGTCGAAGGTGGCAAAATGACGAGCGTCAATTGACTGGTCGTCGCAAACTTTAATGTCATGTTG
GGTGTCGATGCCACGCCGTTGGAAGTTGTCAAGTTGACGGTAACCCACTCACTCACACCGACAGCAGTTTCAGCTCGGACTCGGGAGACGTACGTTGTCG
CTGGCAGTAAAGATCCCAACTGGACTGAGCAGCAAATGAAGTATGCCTGTCTGAGCACGATGCCATCGAGGGTTGCCAGCTCGTAGTAAAACTGCGAACT
GCCAGTTGAACTGTTTCCGCCATCGTCACACGCGGGCTCGACTTGAATGAGCACTGACGATGGACGAATCTCGCTTACGACCACAGCTGGAGACCCCGGT
GAAGTTGGACCCGCTGTGCGGAATGTAGTTCTTGAGCGATTAACCAAACCGGCCCCATTCTCCACTTCCAGCAAGTACATGAAGTTTGTGTTCGCCACCA
GACCGCAGTGGACGAAATCCATTGCCGCTCGAGATTCCAAGAGCACGTTGCCGTTGGCAGTGAGCGACAAGCGTGTGATTGGGGCACCACCGGTATCCTG
CCAATGAAGCCCAAGTGAGTCGACGTGGTTGGATACTTTCAGATTCCAGGGAGGAAAGGGAAACGAACCTTTGGCATTGCCCAAGCGAGACTGATGGAAC
CTCCAGCACTTGCTACTAATTGAATCGTTGGCGCTTCTGGTGCTGTAGCGGAGCTATCCACAACAACAGATATTAGGAACATTTCGGTCAGGCAATACAA
CGATCACCCTTACCTCGTGGTGATATACCGTGGTGACGATGCCGTGCTGTTACCGACGCCGTTCTCAGCGACCATCGTCACAATCTGTGATGTGGTTGCA
TTCAGCCCTCGGAACTCACACGATGCCACCGCGCTAGCATTTGTGGAACAGAGTGCTTCAGTCCGGACAGGAATGCCGCATGCCGCGGACCCGCTAAAGC
AGCACAAAGCTATTGTGGGCGGTGAACACGATCTGGGTGCGCACGTTTGGGCCGTATCGACTGGCAAAAACGAGTAGGTGCCACTTTCATTCGCCTGCAG
TGTATGCGAGCACTGGGAACACGAATTCGTGGTCGAGAAACACTGCACGAGCGAGTCAGCAAACGCATGATATCGGATCGCCGACGTTGGTGATCCCCCG
AAATCTCTGCTCTCGTTGAACGTGAGCGCAAGGGAGCCGCCAATAACGTGTGAGATGTTGAGAATCGTTGGAGGTGATGGTACCGTCGCGGCCGTCGTTC
TCGCTGTCACAGTGTAAAGGTCAAGAGACCCACTCAAGTTGTACTGGTTGATAGCGACGACCCTGATTCCGTAGGTTGTGGAAGCAATCAGTCCAGTGAT
GTTGAATTGTCGAATCTG