Description :
From Genome Similarity Track
Location :
Scaffold_86:30118- 36028
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_86-snap-gene-0.27Conserved gene of unknown function
Pytve_DAOMBR484fgenesh_masked-pve_contig_86-abinit-gene-0.78Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_86-fgenesh-gene-0.7Histidine--tRNA ligase

Sequence
5910 bases(100 bases per row)
CCGTCGCGAGTCGCCCGTTCGTGCCGCTCGCGCCTCGCAGCTGGCGCGGTCGCGTCATGCACTCGAACACGAAGCTCACGCGGCTCGTCAAGGCGGCGCT
GCTGCAGACGCTGCTGCATGCGCTGCGCGTCGGCTCGGTCGAGGGCGTCAAGGTGGCCATCGAGCGCGGCGTGCAGCTCCAGTACGTGGACGCGCGCCAG
CGGAACCTGCTCATGCTGGCCGCGCGGTGTGACACGGACGCGCGGCTCGAGATCTCCATCATCCTGGCAGATGCTGGCGTCGGCATCGACCACCGCGACC
AGCTCGGCTGGAGCTGCCTGCACTACGCGTGCGCCGCCGGCGCGCTCGACGTGGCCACCGAGCTCATCCGACGGTGTGTTCGAAGTGTTTATATAATGAG
GTGGTTGTCTGTGTGGGGACTGACGCTTTTTGAAAAATGTGCAGTGGCGCCAAGGTCGAGTTCAACCCGTACGGCTACGGGCCGGAGGACTTCATCATCC
CCAAGGTCTCGCGCGCCAAGAGCCTGCTGCAGCACACGGAGCAGCTCCAGCACGAGCAAAAGGTGCGCGCGTGCTGGGACTTTTTCCGCAAGAACGCCGA
GCAGACGGGCTACGGCGTCAAGTGCAAGGCGGTGCGTAGTGTTGCTATTGATTAGGTTGCCGTCTCATATTGATGGGGACTGACCTTGATTCGATGCGAA
CTGCAGCACTGCGACCTGGGCAAGCCGCTCAAGGTGACGTTCCAGGCGCCGGCGGGCCACAGCGCGCTCGACCGCATCCGCGTCGTGGACGTGAACGCGG
ACGTGGCGCTCTGGCTGCAGGTGTCCAAGACGTTCGCGATCCCGCCCGGCGAGGTCGGCACCATCACGCTCGACTCGGAGACGCTGGACCGGCCGTCGTT
GTACCGCGTGTTTTACGAAAAGTACGAGCCGACGCCCGTGGCGATCCCGCCCGAGGTGGCCGAGAAGAGTCTGTGCGTCAAGAACCTCGATACGGGCACG
ACCGAGGCGGTCGGCGCCGTCAACGACCTCGTCCTCAGGCAGCTCGCGACTACGCGGTCGTCCAAGACGGCCAAGCACCTGTCGGCTTCGTCTCGCGAAG
CCCCCAAGTCGGAGAAGGCAGAGCCGGCCGCGCGGGGTCTGGCGTCCACGACGTACGTGCGAACAAATGAGTTCCATGTCTGATTATCCTCTGTGGATTA
TAGCTAACTGATATCCTTTGTGCCAAGCAGTCGATTTCGCGAGAAGCGCGAGGCAAGTCACGACAGCGCGGACGAGGAGGAGGACAGCGGCGAGTTCTCG
TCGGACGAGACTCTCACGGCCGCCGACATCGCGGAGCACCCGGCTGTGCACAGCATCACGGGCGTGTACCAGACGGCGGCCATGGCGATCGTGAGCGTGT
CGACGCTCAAGAGCGCCAAGGCGAACGAGTACGAGGTCGTCATCAAGCGCGACGGGCCGATCGGTCTGAGCCTCGAGCCGCGCGCAGACGCGTCGTCGTC
GAAGAAGAAGCCGCTGCGGTCGACGCACCTGATCGTGCGCCGCAGCCAAGGCCAGGCGGCGGCCGTCAATCCTGGCGACTGCCTCGTCGCGATCGGCAAC
GCTAACATCGAGCACGCTGGTCTCAAGCACACGTTGTGGGCTCTCAACGAGGCGCGCCGCCCGCTCGTGCTGCGCTTCCGCCGCGGCAACGCCACAGCCA
AGAAGAGTTTGTTCGCTGCGGGGCTCTCGAAGCTCTCGGGTCCGCGGCGGCAAGCGGCGATCGCTGTGTAGTGACGACGGTCGCACGCTTGACAGCTCTC
TTATATAATGTCTTGAGTGGTGGTCGCGTGCTGTGAGTGAGATGAAAGCGAAAAGAATGTGGCGGTGCGTCACCGCCGCTGATGCGAGAGAAACATGAAC
CGAGTAAGATTTACAAGCGCCGCGGATCGATGTCCGATGCTTTCGTCGTAATGTTGTCTGCTTCGTCCGTCCGTCGTTAGAGCATCGGGTGGCCGTGGTC
GACGTGACACTGCTTGAAACTCTTGCCGTAATTGCGGCACGCGGCGCACACTCTTCCAGGCGTCGACGCTACGTCGATCACATGCATCGGGTGACGCTGA
TATATTACAAAACTCATTAGTCAGATCAGGCCGTGGTGACGGGATAGAATGTGTCGTGTCTGGCAAACGCACCTGAAAGTGCTCCATCAACTGATCCGGC
GGTACTTCGATGAGCTTGTCGTTGTCCGTGTCGTACACAATGGCTGGTCCTGCATAGGAGATCATCACAACTTGAGCACACAGAGCCAAGTTTCAACACA
CCATGACTGGCAGCGTACCTGCTCGTCCCTCCTGCCGCCATACATACCAGGCCTGCGCCTCCCACCACGCAGGTTCGTCCGAGCCTGCGTTCGTGTACTG
TTCACATGCACACACGCATTTAGTCAGTTGCTTTTGAACGCAAACCCAGTCGAACAGTCCACATACCGCAATCGCCATGAAGGAACCTGGCCGCAGTGTG
GCCGCCCAGTCCTTCACCTGAACGTGGAAGTTGCCCGGCGCCTTGGTGCCTTTGTACTTCTTGCGCAGGTGCCACTCGCCTTCCTTGCCGTTCCCACGCA
GCGTTATCCACGGCTGGTGTTCTTGGAACCGCCAGGTGTTGGGCATGATGGTGCGGTGTGGCTCGTTCGGGTCGAACTCGATGATCCCGAATGCCCAGTG
CGGGAACTCTGCGCGCATCTGTCCTGTCTTGTATCCGGTGTAGTACACGAACATCTTGTACACCTGCCACGATCCAAGAGTCAGTACCAGGTCCAATTGA
TGACGGAACCGCCACATCACTTGACCTACGCAATTCATGTGCATGTGCATGTAGTGTGCCCACGAGTCGTCCTCCCTCTTCTCCTCCGTGAGCACTCGCT
CCTGGCAGACCGCTATCTTGAGGAACTTGCGCGTGCCGATCTCGGCCACCACCTCCACAATGTTCTTCCACGCGTGGTTGGTCTTCAAGCACACGATCCA
ACATGTTAGCCACATGCAACGATCGCCTTCTCAGCGTTACGTACCATCCCAAGCCTACCCAACGCCGGCGCCGGCAGGAACGACGCGATGAACTCCTTGA
TATCCATGTCGAACTGGGAGAGGTTTGTCACTTGCACGTAGGCTTTCACTGGCCGCCTGAATGCTCTCTTGCTCTTGTTCGGTGTGAGTTTCTGCTCGCC
AGCCACTTGCTCTGTCGGCGTCGAAGGCTTCTCTTCTTCGTCATCATCATCTATTACCCGCTTCTTCACGACCTTGCCCACCAGGTTCTTCTGGAACAGC
ACGCTCTCGATGCGCAGCATGCAGTTGCACACCTCGCGGCCGTTGCAGCTTCTCGTGTGGCGGATCAGCAGTCGTGGAGCTGCATATTGCCGGATCGGAG
CCTTCGTCTCAGCGTCCACTAGCGGGAGGTCGACACTGGTCGCTACAGGCGCCGGCGTCTCCACGACGGCCGGGATCTCTTGCAGCTCCATGGCGGCGGT
TGAGCTCACAGCAAACGATAAGGCGCTATGAAGCTCCACAGTAGCACCCAAACGAGGCAAACCTGCACATTCGCATTGTATGGATCCGACCCATGAAACA
TAAAGTACGTGCGAACTTTACGAAACTCACCTTGACACGCGAAAAGCACCGCATTTTGAGCGGTCTATAATGCTCAGGATGCGCTGCTGTCTGCGTGCAG
GCGCCGCGCGAGCCCCGCGCACGGGCTGGCAATGCGAGCGCCTGTTCTCTGCAGAGGCGGAGTCCAAGAGCGGCAAGGCGGCGACAGTCAGCCGCGTCAG
AGGCACGCGCGACCTGCTGCCGGACGACGCGGAGCAGCACCAGCGCGTTGTGCGAGTGCTGCAGGACACCGTGCAGCGCTACGGATTTCGGCAGGTTCGT
GCGGCCTCAAAGGCGCCGTATCACAGACTTTCGCATTGTGTGTGCTAACATTGTGTGTTGAACGGTAATATACAGATCCAGGTGCCGCTGATGGAGTACA
CGGACCTGTTCTCGCGCTCGCTCGGCGATGGCTCGGACATTGTCATGAAGGTGTTCACGACATGAGCTCGTGATGTGCGTTGGTTTATTTGATTGTACTG
ATTACCGCGGGCGGTGCATGGCAGGAAATGTACACGTTTAAGGACAATTCGGGCAAGAGCGTGACCCTGAGACCCGAGGGTACCGCTGGCATTGTTCGAG
CGCTTGTGAGCAACAACCTGCTCTACTCGCTGCCGCAAAAGCTCTCCTACAACGGCAGCATGTTCCGGTGAGACTCTTTTCATGAATATATCATTATGTG
GGACGTTAATATATGATATGTGGCTGTTTCGTTAGGTACGAGCGTCCTCAACGCGGCCGCTATCGCGAATTCCAGCAGTTTGGTTCGTTGGAACGAATTG
TGTTTGCTCGGAGCGCTGCGTAAGAACTAACAATGTGACTGGTGTGCGCAGGTGTGGAGTTCATCGGGTCGTCGGGGCCGTCGGTAGACATCGAGGTTGG
CTTCGAGATATTTACCACGAGATGAAACTGGATCAAGGCACTCATTCTATGCCGAATTGAACCTGTCAGGTTATCGCATTGGCTGCAGATGCGCTAAACG
CTCTCAACATCGGTGATAAGGTCGTGCTGGAGCTGAACACGCTCGGTGACGGCGAAAGGTACTGTTGCACTGATATCGATTGCTCAGCGTTGCTGGAAAA
GCGCTAATCGTTGAGTGCAGTCGAGCCAAGTACCGCGCTGCTCTCAAGGACTATTTCTCGGCGCACGCGAGCGAACTATCTTCTGACAGTATTAGCCGGT
ACGCAGCTATGACCAGGCTTGTCTGTTCGACTTTAAGTTTGAGCTGACGAGTCCGTGTCATAGTCTCGAGCGAGGAAGCGTCCTCCGCATCTTGGACTCC
AAGGACAAGGGCGACCACGCTGTTATCGCCGACGCGCCTCGACTCAACTCCTATCTGTCCGTCGAGGCAGGAGAGGTATGCTCGGAGAATCGGATATCTG
AGCAGAGAGCGTGGCTGATTCATGAGGTTTCTTCATTCCAGCGGTTCGACAAGGTCTTGCGAGGGCTGCAAGCTCTTGGGGTTGAATATCGACAGAACTC
GCTGCTCGTCCGTGGTCTGGTATGTGCTGCGCGCCATGTTTGCTAGCCTGCTATACTCGCGTCCTGAGTACGTGGCTGGCTGCCTGTGCAGGATTACTAC
AGCCACACGGTCTTTGAGTTCGTCGAGAAGCCACAGCAGCCTTCGAGCGACAGCGAAGGTTCAGCTGGTGGCATCGCTGTCCTCGCTGGAGGGTGTTACG
ACAACTTGGTCGAGATGCTCGGCGGTCCCGCGACCTCTTGCATTGGCTGGGCGGCTGGTGTCGACCGCCTGAATCTGTTATCCGGAGCGACGCCTGCCGT
CCCTGTGTCCATTGCGGTAGGTGAATCTGTGCTGCACGAGTCGAATTGAAATGCTGACTGCTGTGTCTTGGACAGATTGTCCCAGTGCTGGTTGGAGACG
CTCAAGAGCGAGTGCTGCACGAGGCGATGCGTGTGGGGCAGGTGCGTTTTGGCAGAGTTGATCTTGAAGCCGAATCTCAGTCAATCTGACATGATTGGCG
GTGTGCTCCATCGAAAGCTCTTGCGACAGCGCGGCTTGGCCGTTCACTTTTGCCATGGTCGTGGCAACCTGAAGAAGCAAATGAAGGTATGCTCGTCCGT
GTGTGGACTCGACTAAGCATGTCTTTGAGTCTAAGGTATCCGTGTCGATTCTCCCCTACGATCCTCGTTCAGGCCGCGGAGCGCTACGGCAGCGCGTATG
CCGTCATCCTAGGCGGTGCCGAGGTTGACAACCGCTGCGTCAAGGTCAAGCATCTCGGCGAGCGGCGTGAGGAACAAGTAGCTGTCGATGCGCTGTCCTC
GTTTGCCTTC