Description :
From Genome Similarity Track
Location :
Scaffold_17:301134- 305426
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007086Protein of unknown function

Sequence
4292 bases(100 bases per row)
TCGCCTCGCTTGGACCCGCAACTGGGCGGCTACCCGCCAGATTGCGGCTCCAAGGAGCTCAAGTACCTCTCGTATGCCAAGGTGCTGCACGACCGCGGCG
AAACACACCCGATGCGGTACTCCATGACCGAGTTCGATGCCCGCGGCAACGCCAAACCCGAGACGTACCTGCTGAGCACGGACTTTGGCGCGCACTCGTT
CCACCGACTGCCGACAGACTCGAGCGTGCTCAGTCCCTATGGCGTCGGCATGACGCTTTACTTCAAGTACCTCAAGGTCATGACGTGGCTCTTCTTTCTA
CTTGTAGTGCTCAGTGCACCGGCGCTCGTGATCTTCATCGTCGGTGGCACAGGCTCGCTCGCTGAGTTCCAGATGCTCGCCAAGCAGAACTTCCCGATGA
TCCTCGGCATGACGAGCATCGGCCACCTCCGCGAGTCAAGCAGTTTCTGCGACCAGGTCGCCGTCGGCGGTACGCTGTCGCTGACGTGCCCTGCGGGCGA
GATCGGCTTTGTCAAGGCTGTGTACTCGACGCAGCAGTCACAGGGGAGCTGCTCATGCCCCGAGATCAACAAGGTTGCCGCTGGCTCCGGCAAGTGCCGT
GGCCAAGCCGTGCGGTCGTGCTCGGCCGTGGAAAACTGCACGACGACGTGCCCTAGTGACGGCTACGGGTGCTTCCTGGGCGTGCACCCCGTCTCCAAGT
GGGCGTGCTGCGCCACGTCGCTCGATAAGGACACTGCGCGACCGAATCTCGATGGGATGAAGATCCGCTCGACACGCAAGTGCGGCTCGCGCACGATCCA
GGCGATCGTGGATGGGCTCTGTCTCGGCAAGAAAAGCTGCGCCATGGAAGTCCAAGAGGACCGAGTCTACGAGTGGAAAGTGGACGAACAGTACGCGACT
TCGTGCCCCGAAAACAGTAAAAGTAGCTCCACCACCAGCAATGACACGTCGACGACTCCAGGTACGATCTGCCACGCGGGCATCAACGACGACAGCGACT
ACAGTCGGTGTCCCAGCAGCGACCGCAGCCTCATCGTGTACGCGCGGTGTTTCACGACGCGCATTGACTTGTCCAACGAATGGAGCCTCAAGATTGTCGG
ATGGGATTCCATCAGCGTACGTAGGGCGGTGTAAAGCCATCAAGTGGTAGGGGTCTTAGCTTTAACCTTTTGAGTGTTGTGACGTTTTGTGTGTGTGTAT
TTAACAGCGTCAGGGCTTCCTGGGGCTTGCGGTCGGCTGTGACATTGCGTGCAGCGTGTTCTTTTTCCTCATCGTGGTCTGGATGAAGCGCAAGGAGCAG
GAAAACGTCGAGCGCATTACGAAAGACCAGATCAAGGCGCTCGACTACACAGTGCAGCTCGTGCACCTGCCGCGTCACAAGCATGTCGGCAAGCTCCGCG
AAGAGGTACGCTCAAACAGCGAATACTTTTACGTCTTTGCCTCACTTCAGTCCTGATACCACCACTCAATGTAGATCCGCGCGCATCTCGAGACGCTGTT
GACGAATTCACCGCGATACGCTGTGGATCTCGATCGGGTCCGCATCGCCGACATCCAATTCGGGATGAACACGTCCGGTCACCTCAAGCTGCTGCGCAAC
CGCGGCGCCGTCGTGCGACGACTCGACGTCGCACTGCAGCGGTACGAAAAAGTGCGCATGCTGCGGTCTCGCCTCACGCCGCGCGTATTCGAGTTGCGAA
GCAAGCGTCACAAGAAAAAGATCCAGCGACTCGAGACTAAACTCATGCGCCACAACGCGCGCCTCGACCGCTGGAACGCCAAGCACGCACAGCGCGCGTC
GGCCCAGGCCGTCACGGCGTTCATCACGTTCGAAGAAGAGGAGGGCTTCAACCGGTGTCTCCAGGAGTACCCAGACCTGGGCGTGCTCTATCGCTTGTTC
CAGCCGAGTCGCAAGCGGTTGCACGGCGAGCGGCTTCGCTTCCGCCCAGCACCGGATCCGAGCGACATTGTCTGGGAGAACCTGCACCATCCATTCTGGG
AGCGCATGCTGCGGCAAGCGGTAAAACGTTTTTTGCGATTCTCTTTCCTTCGTCATGCCATGCATCTGAGTCTGTCGCTGATCTCTATGGACTGACTGTT
GGATGCTCCCTCACTAGATCGTCGGGCTGATCACGCTTGCCGTGCTGTTTGTGAGCTTCGTGCTGATCTTCCTCGCGAAGCTGCAAAAGACCAAGCTCGA
GCGCGAGTTTGGTCGCCCCACGAGCTGCCCCGCCGAGGTCACGAAAGAAGCGGTCGTGCAGGACGAGCTCGAAAAGCAAACGGGGCTCGTGCCGTACAAG
GCACTCGTCGAGTGCTTTTGCAAAAGCATGCTCGCAGTCGAGTGCGTTTCTTTCTCCTCCCCCTCTTTCACTTTCACTTTGCTGGACACAGTCTCTCACT
TCGTCTCTTGCTCTCGTGTGCTACCACTGCAGTTCGTTTCAAGCGATGACACAGGAGGCGTTTTTCAACCCTGTGACGAACCGCGATGAGTTTTACTGCA
AGACGTGGGCGACGTCGTTCATCAAGACGCAGCTACTGTCGATGCTCTCGGTTGTCATGGTCGTGCTCGTCAACGTGCTGCTGGCGCGGATCCTCAACGT
GCTCGTGGCCATGGAGAAGCACCACACCGAGTCAAGCCAGGTCGTGTCGCGCATCACCAAAGTGTTTATCGCGCAGTTTTGCAACGCGGCGCTACTCATG
GTCGTGATCAACGCCAACTTGAGCTACTTTGTGGACGACCAGAGCATCGCGCTGAGCTCGTTCGCGATCCTGAACGGCAAGTACAGCGACTTCACGCCCG
CGTGGTACAACGACGTCGGCATCGCGCTCATGCTCACGATGATCATCAACACGTTCAGTCCGCACATGTACGTCGTCGTGCACTACATCGCCATGGAGGC
GAAGCGGTTCTACGACCGCGGCTTCTCCTTCGACTACTCGATCACGCGGCAGGACACGCAGCGCGACTTGGACGCGCTCTACCGCGGCCCGAAGTTCGAC
CTCGCCGCGCGCTATGCGCAGACCCTGACGTCGATTTTCATCACCTATCTGGTGTGAAAAGCATGCCTGGACTTTGAGAGAGTCTCTTTCTGACTCTGTA
CTGACTTGGGACGTTGTCATGTCGTTTGCTCTAGTTCTCTGCTGGAATGCCGCTGCTTCACCTCGTCGGGTTCTTCGCGATGCTCATGACGTACTGGGCC
GACAAATTCAGTACGTGCTCGGAAAAACATTCTTGCTGGGGTCGCCGCATGCGTTTCACTCCACGTTCTCACATGATGCTGCTGTTGCTCTTTGGTGCGT
TTGCTATCAGCATTCCTTCGGATCGCGCGGTCGCCGCCGCTCTACGATCGCAAAGTCGCAATTGCAGCGGGCTCACTGCTCCCGTACGCTGTGCTGCTGC
ACTCGGTTGTTGCGATGTGGATGTTCTCCAACGCCATGATCTTCCAGTCGGTACGTCATGAAGCAATCGAACTCTCTCCCTGTGTCTCACAGGAAGTAGA
GGCACTCACAGCCGCTAATCGCCTGTGGAAATGTGTAGCCTGACGATATCGCGAGCGAACTCGCCTCGAGCTCGACCGTGAGTTCGATCGGCGACGGTAT
CCCCGAGTTCGAGACGGTGGCGCGCGGTGACATTTGGCCGCGACTCACGCGCGCGCAGGTCGTCGTGCTCTTTGCGTTCTTTATCGTGTTCTGCCTGGTG
GTGGCGCTTCGCATCCTGCTATTCGAGTACTGCCCGTCGATGCTGCAAAGCGTGTGTCCAGTGCTCACGCGCCTGATGCAGAAATCCAAAGTCGCCAAGG
GAATCCCCAACTACTTTGACGGTCTGCTTTTTCCTGCACCATTGCCACGAAGCGCGCACGCACTCACAGAACTGCAGAAAACTTACCATCTGCAACATGC
TGCTGCGGCCGCTTGCTTTTCCTCATTTTGTAGCGATCCCAACGCCGATCTTGCGCGAAAAAGTCAACGACCCGCGCGTGAAACCCGCACTTCGCGACAA
GTTCCAGGCCGCACTCGTCAAGCGCGAGCCTCTGGGGAGCAGCAATTCCCCGAAGCGGCGAGCGCGGCGCTTGGTCTCAGCGGCCGAGCAATACAGCGCC
GCGCACTGGATCGTCGGCTGCCCTTCGTATGGTATGTACGTCGCTTTGTCTTTTTGGCGCACATGCAAAAACCTACTGCATGCTGATGGAACGTGAGTGT
GAATGCAGCCATCAGCGACAACAAAGAGTACGTCCACGAGCTCGCGATCGACTCGCACTTGTCCGAGGGTATCAGCGTCGAGGAGATCTTCT