Description :
From Genome Similarity Track
Location :
Scaffold_195:30113- 35487
Transcript NameFunction/comments
Hyaar_Emoy2812357hypothetical protein
Hyaar_Emoy2812358hypothetical protein

Sequence
5374 bases(100 bases per row)
CACAGGTATCAATCAACAAGATCTTTCGAAAGCGGTCTAATCTGGAGAATATGGATCCAAGCGGCCTAAATGCAAAGCGACAGCGACTGGTTCAACATCC
CATACTGGAAGAAGCTGTGTCTCTTTGGGTCCTGCAATGTCAACACCGCGGAGTGATTATCACCAGGGATATCATCTGTGCGAAGGCTCATCGGATTGCT
CAATTGCTTGGTACTCCTGATGACGCCATCACTTTCTCGCACGGATGGCTTCATAAATTCCAGCAACGTCGCATGCTCCGCGCTATCGACATTTACAGCG
AAAGCGGCTCGGTGGACGTGGTGGCTATGAATAAAGCTCTGCCTGATGTAAAGAAGGTCATCGCAGAGTACGCGCTGTGTGATGTTTACAACATGGATGA
AACCGGTAAATTTTGTTTGTTATATTTCTAATTGAAACCGAGTCTGACAAAATTAATTGCAGGGCTATACTACAGCATGACACCTGACAGGACTATTGCA
CAGCAAGAAATTGAAGGACATAAAAAAGACCTGGTGAGTATATTGCAGAATGCTTGTTGCCATATACTAACACAGGGGTACGCACTGACATCCTATGCAG
TCGCGGATTACAATTGCGCTCACAATGCTGATGGCTCTGACAAGCTGCAGCCTTTCTTTATCGGGAAAGCCAAGAAGCCCCGCTGCTTTGACAAGAAATC
AGGTCAAGCACATGGATTTCTCTATCGCAACAACACAAAGGCTTGGATGACGGGCGTGTTCTTCCAGGAATGGCTTGCAAATCTAGACAAAACAATGAAG
GTGCGCAGCCATTTGAACTTAGAAAATTTATTATTCTAATATTGTATTGTTTCAGATCAAAAGTAGAAATATCCTGCTATTGATTGACAATGCTCCGTCG
CGTATGACGAATGAACTTACGTTAACTAACGTCAAGGTTCAGCTGCTTCCACCACGTACGACCTCCATGATTCAGCCGATGGATGCTGGTGTCATCGCAG
CGTTCAACCGGCGGTATCGCCGTTACCATCTGCAGAATGAGATCGACTGTGACGAGCGTAGGGAGGGTTTTAACATCTACAAAGTCGACCAACTTACTGC
CATGCGCTGGTCGGTGGCTGACTGGAACGAGATTTCAAGCACTACCATTGCCAACTGCTTCAGCCACACGGGGATTTTTCTACTGAATCGGTCATTTCAA
GTGCAGTGGAGGTGGAAAGGAGTAAAGATGGTGCAACGGAGGTCGAGGAGAAATAAAGTGAGCTGGAGCAAGAGCTGATATCACAGCTCGAGAAGCTACG
TGTCCGAGATCCCATGAAGATTTCGGAGCTTCTCGATCCCATCGAAGAGGATGAGACTGCTCAGCCTGAGCTGACCGACAACGAGATTCTAAAAGAGGTT
TTGGAGGCAGATAATGAGGAGGAAAACAGTGAAGATGCGGCACCTGTCGCAGAAAATTTTACCAGAGCCGAGAAGATTAACCTCCTTCGTGATGCCTGCT
CCCTGCTCGACGTATCCCAGGAAAGTCACCAAGCTGCTTATAAAGTCCTTCGCAACCTCCAGCTTGATCTTCGCAACACTCCCACCACCCAAACCACCCT
CGACATGTAGTTCAAGTAGTTTTTCTCTTCTATGATACGAAAACTAGTGGTCATTTTTAAAGTTATATTGCCCTATTTGATCATAACTTAAAACTTATAA
CTTAGCGCCCATAAAACGAGGTCCGCAGACGCGGAAATCGATAACCTACTAGAGGTTACAACTTATCGGGGGGAAACTTATCGGAGGGAAGACTGTATAC
TATTAGCTTCCTCGTAACGCGCGAGTCTACTGACCTCACGAGTTAAGCATGCACCCGAACTACCGCATGTTACACCGCGTTCGTCACCGTCTATGTATCG
CATGCCCACGAATCTGTGCGTCCCACCACTTCGTTCACCAGAAACATCGACAGATGATACGATAATCTGTCACCGCTGGTCGTCTTCGTAGACGCACCTT
GATACCCACAAGTTTTCCAGCAGGTTCTTCTTCGTGCTACTGTTGCGTCCAGAAAGGTCAACATCGCGGGCTGGGTAAGGTTGCGTGATCTCTAGCACAT
TTCAGTGCAAGGATGAAATGTTTGAAAATGAAGCGATTGCCAACATGCCACTAAGCTACTAATACACGTTCGTCCAGATTCAGCCTTTACCTTGTCCATC
GTGCTTCAATTGATTTGAATACGCACATGCGTCTGCTACTATCGACAACTCATTTTAAAAGTGCAGCAGAGTATTCCTTCGTGCTTTCTCAATAGCGGAT
ACCTTAATGATCGTGAAAGACTGTCTCTTCCTAGACCAAAGTCGAGTCCACCTGGGAGTAGGGTCCTTTGTAGAAACTAAAAGCGTCTTGAAGCCCTCGA
GATCTTGAGCTAGGGAACTGATAAGCGTAGCTGCGATGTAACACTGGAGTCCGTCCAGGAGTCTGTTCGATAGTCGTGCTCGAGTGCAATTCGGATATCC
TAGATACCGAGACTCGACGCGAGCCCGGCGTGGCCAAAATGACGAAATCACTCGAGCCAGGTGCAATGCCTGAGCTCGGTTGAGGTAGTAAAGGTACTTC
GCGTGATGTCTGCGAGCTGGATCGATTTGTTCGTGAGCTTGGACGTTGGCAGTCGTCATAGGAAGCGATGCTCCGCCTCAAGAGCGGGTGCTGGCGCCGC
TGACTTGTGCGGCCACCACTATCACTGATAGCTTCGTTATGTGCAAGGATCAACAGATGCAGCAATTGGCCATACTCGACTCGGGTGCCATTGAGCTCAA
AGAGCATCAGTGCGACACTATTGAAACGAAAGCGGGTCAAGCGGTAGCCAAGTACTGCTAAAACCGATCGAAGTCGGTTCACGTCGATCATCCCGGTCTG
CTCTGGGTCATAAGCACGGAGTTCTCGGTGCAAATCGATGATCGTGGAGTCCCGTTCCTTCAAACAGTCGAGCAAGGACGACGCAAACTCCGACCGCAAT
TCCACAATCTCGCTGAAATGCGCGATCACTTCACCCAACGTATTGGCGTCCACACGGAGGATGCTGCAGACGATGACAAAGTATCGGAACATGCGCTGCT
GAAACACAAACGTGTTGAGAATCAAAGGGAGCGGAACCACAATGGCTTGAACCAGTCCAAACTCCATGTAGATATTGGTCAAGTCGTACACGGCGCACTG
CACTAACAGAGCAATGAAGAACCCATTGAGAATCAGCATAAACATGACTGTGACGTGCCACACTTTGCGTGAGAAGAATCGGATGTGGATGTTTGGAGTC
CCAATCTGTACTCCGCTTGGTGTTCGGCTGATGCTGATACCCGTGTATGGTTCGTTCATTTTTCGGCAACAGGTTGCCACGAGCTGCAGGCCAACGTCTT
TTCGTAGTAAAACGTGACGCTCGGCATTGCGACTATCCTGGATCTCTTCAAGTACTTCGTGGACTCGATTCATGGTGCATAAAGCAGTGTCCGCTACTTC
CATGCGCGAGGCAGCAGCTTCTTCTTCCGCGATGGAGCGGAGGTTGTCAACTAGCGTCGACTGATCTTTGCTATACCCAGCAGCGACAAGAAGCTGGTGA
ACGCACGCGCGGAAGCACAGCAGCACCACAATATGTAGGATTACCAACACCCAGGCAAACACAACAAACACTTCAACGAGCTCATGCTTTTCAGGGAGAT
CCACGTCCAGTTCTTTGAGAGCATCGAGGAACCCGCAAAGCGTCCAAGCCACTGCCAGCAAGAGCACCCACATGGATGGCTCGACTTCAATCATGTGCGA
GATCTGGTTGGCTTGAGCTCGACGAAGGTACTTGGAGAAGGGGAAGAGCTGCGGCAGCCCAAAGCGCCGTAGAAATAAGTGACGAAGCAGTCGACGCTCG
ACGACTTCCAGGTCAAATCCTTTGGCGGATTTTCTCGTCCAGCAAAACCATCTCGGCGCTCTCGTTTGCGTAAAGGCTTCAAGTGGCGGCGTTCCAGCCG
GTGGCCGCATCGCGTTGACCAAGTCTTGCGCTGTGATGAGCTCAGTTTGGTCGGATTCTTTGTTGTGCTTGCGGAGCTGCGTGAAGACAACGATCGCTTG
CAGAATGAGAGCAAGGGCAAAGATGAAGATGGTCAAGTCGGCCACTTGGAACGCTAGCATCGTCTTGCCAACGGGGTGGATACCTGGCACTTCCTTGAGC
AGTTTGAGGCCAAGACTCAGTAAACCAAGAGCCATGAGTTCCCGATATGCCTTCCGAAGCATGTGATGGTACTTGTCATAGCGAGAGAGCTTTCGTTCTA
CGTGGTGGAGTGCTGCCTCGAAAAGAACGAGACAGAACGCCAAGATGCTCAAATGGATCAGCACCCGCCAAAACTCGACATCGATACCAACACGGAAGAG
TGATCCGCCCTGCATTAAGCTGAAGTTGAAGTGAGACCGTCCTGCTGAAAAGCTCAAGACGATTTGTAGTACGTCGTGGTTCAAGTGTCGTGTCGGTCTG
TAGCGATGATACCGTACAATGTTATGTGGCAACTTGGGTCTTTCCTTCTCTACGCAGAGACGACAGCCCATTGCGCGTGATGTGTCAAGCAGGGAGGAAT
AGGAGTTTCCAGCGGTGAAAACGCACTATCTCACAGTTGTCGTCAAGCTGGCCAGAAGCTGCTGAAACTCCAGCTGCTGACGCCAACGGATGAGACCGAC
CTTCTGATAACGAAGTGGTGTGAACAGACAAGGCCCATTTGGCCGACGCAGTGTGGCCACGTTCTGATGATATCCAATCGATGAAGCGACATCGTATCAA
TTTACATTACACCACGGGCCAGAGATAGTCAGAGGTCGACGACTTTGTCGACAGGTTACTCATCCATTCATTCATCGTACATTATACTAGAGCGCTTCTG
GTTTATTCGTCGATCCTAGTCGATGTTGCTTAGCCTGCACGGTACAAAAGTACCAGGCTCAAGCTGGTTATGAAAGATACCCAACTCAAGGACAATAGAC
ACCCGTCTCAAACACTTCAACATACCTCGGAATCGTACTCGATCGTGAAGACTGTATCATCGCGCATGCCGGATGTACAAAAGTGGTGCTGGAATCCAAT
ACTGCTTTAATGCTGTACAGTTTTCTGTTCACGCTGATGGACATCCTTTCGGTCTTGAGCTTTATGGCCGATAAAGCTGTCAGAGACCACCTTAGGAGCG
ATCAATTCGTATTTTTGTTATCACACTGTCAATGAGGATTGAGCTGCACGCTCCAACTGCGCCCCTCGGAGGTCTGTAGCAAGGGACGCTACGTACGTAA
TATCGCGACAGAACACGTTTCGAAACCACCTCGAAGCGACAGTCCTGTTTGTCGGTACACTGTAAAGGCCACAG