Description :
From Genome Similarity Track
Location :
Scaffold_25:301118- 304347
Transcript NameFunction/comments
Phyin_T30-4PITG_12932Putative uncharacterized protein

Sequence
3229 bases(100 bases per row)
GCAAAAGCAGTTCTTAACGTTTTCCATCATTTATCAGTTATATGTCGAAGCCACAGCAAAGAAGTCCAATGGAATCCTGTATGATAGGCTATCATACCGG
TAGTAGTACTAGTACATGTAATTCAAACAGTATCTTAGGTTTCCTAAATGTGTGTGTAGCAGCGACATCGCTCGCTATCGGCATCCGTGATGCGGACTTA
GATGTGTTCAGAGTCCGTCCGCATCGCGTGCGTCCTCTTGTTTGTGGCTGCATCCAGGACTAGCAGCTGCCAAAAAGTGCAAGTTCGCGAGACCTTCTCC
GTGGGGATCCATTATTCAACTTGCGCTCTTCAGCTTCAGGTTAAGTCCTCCAAGTAACTGGGCTACAGTGTCCGAGCAGATCACCCATGCTTCCTACGTC
TCTGCGCTCGTTATTACAGTCGGTGTAAGCTATTCACCTCGGAACCTTGACACCATGGATGACTCGTAGACACGCTAAGCTTGCTTCACACCGACCGTGA
TGCTGCACCCGGACACGTATCTGAACAAGATTCTGGTGGGGTCGGAGCAAGGAGCACTGCAGTTGTGGAATATCCGCAAGATAAAGTGCATTTACGAGTT
CAAAGGATGGGGGAGCGCTGTCAACGCAATGGAACAGAGTCCCGCAGTGGACGTCGTGAGTATCGGACTGGCCGATGGAAGACTCATGGTGCACCACTTG
CAGCTAGACCAACAGGTGCTGGACTTTAAGCAGGACCAAAAGAGCGGGATCACAGCCATGTCGTTCCGTACGGATGCAGGCGCTTCGACGACTCCCTTGG
TGGTGTCGGGGTCGCGATCCGGTGACATTGCAGTGTGGAACCTGCAGACTAAACGTCTCGAGTCGGTGATCCCAGGTGCACACGATGGTGCGGTAGTCTC
GCTGCAGTTCTTGGCGAACGAGCCGTTGTTGCTGTCTTCGGGTACAGATAACTCCATCAAGATGTGGATTTTCGACCACCTGAACGGCGGCACGGCTCGC
CTGCTCAAGTCTCGTGAGGGTCACCGAGCCCCGCCGACGCGTATTCGTTACTATGGCAATAATACTCTCGCTACGATGGCGGACGGTGCGGACGGCACGT
GCTGTCAGATCCTGTCGGCCGGTCAGGATCGCGCCTTCCGTGTGTTCCACACGGCTCGGGAACAGCAGAGCAGAGAGCTTTCCCAAGGTCCAGTACTCAA
GAAAGCTCGCAGTTTGAATGTGCGGTTGGAGGACCTGAAGCTGCCGCCCATTGTGCAGTTCGCGGCGATGGAGACGCGTGCTCGCGACTGGGCGAACGTG
GTGACGTGCCACGAGAACGAGATCGCGGCGTATGTGTGGCGCTTTGAACACCGAGCTATTGGCAAGAAGGTGCTACGTCAGTTCGACCCGAGCAACCGCG
TCCCATCTGGTAGCGTGGAGGACTTACGTCGTAAGAAGACACAAGCTACAAGTGTCGCTATCAGCTCCTGTGGCAACTACGCACTAGTGGGAGGTCTGGG
TGGTTCAGTCTTCCGATACAACATGCAGTCTGGTGAGAAGCGTGGCTCGTACCCTGTAGCAGCGACACCGAAGGCGAAGATCATTCGCTCACTGATACTG
CCTGGCTCGGATCTGTCAGCTCTGCAGAACGATGAGGCTGATAAGACTGCTGCGGATGCTCACGATGGACCGGTCAGTGCGGTGGCTGTTGACGCGCTGA
ACGAGACGCTGGTGTCAGCGGGTATCGACGGCAAGCTCAAGTTCTGGGGCTTCAAGAAGCACGAGCTGCGCTTTGAGATGGACGTTGGCTCTCCGATCAG
TCAGATGGAGCTGCATCGCGACAGTAATTTGCTCTGCGTGGCGTGCGATGACCAGGTGCTGCGTCTGTATGACGTGACGACCCACAAACTTGTACGTCGC
TTTGCCGGCCACTCGCACCGTGTCACGGACATGACGTTCAGCTCGGATGCGCGGTGGCTCTTCTCGTCTTCAGCTGATGCCTCGTTGCGTGTGTGGGACA
TCCCGACGGGCAAGTGCGTGGACTGGATGCGTTTCCAGAAGCCTGTGACGGGTCTGGCTGTGTCCCCGACGGGCGAGTTCCTCGCTACTACACACGTGAG
CCACGTCGGTATCTTCTTGTGGGCGAACCGAAGCTTCTTCACCGAGGTCTTCCTGGACTCGGAGCCTACGGAACCCATCCTCATGGACATGCCTGTGTCT
CTCAACGAAGTGGATAACAGCGACCAGCTCGGATTTGGCACCGAACGTAACCCACAACTGTCCGTGTCAAGTGTTATTGAGCAGCCTAAGAGTGTCAAGG
TGGAGGAAAGTGAGGAGAGCTCGGACCCACTGGACGCGTCGTTGATTACTCTGTCGACGGCCCCACGTGCGTTCTGGCAGTCTTTGTTCAATTTGGAGCT
GATCAAAAAGCGTAACAAGCCTATTGAGCCTCCGAAGGCCCCCGAACAAGCCCCGTTCTTCCTCCAGACAGTACGTAAAGACGATGTCCACCCGACTTTC
GTTCCAGTGGCATCCGAAGCGAAGAAAGAAACTGAGAAGAAGGACGAGGAGGACGTTGCGATGGACGGCTGGGGTGCTGGTGATGATGATGAGGCCTGGG
GTGACGATGACGGTGAAGAGCCGGAAGATGAAGTGGCTGCTCCTAGCTCCCGTATCGTCAAGACGGAGGGCATGGTGACTACCCGCTGTAAGCTAGCAAC
GCTGTTGGCTAAGGCTGTACAGGAGGAGGAAGACGAGGACCACACAGTCTCGCGCTTCAATGAGGTGGCCAAGTACATGCAGTCGCTGTCTGCGTCGGCT
GTGGACGTCGAGATGAGCACTCTGTGCATGGGAGACTTTGACGAGGAGGGGAAGAAGCTGCTCGGTTGGTTCCTGGATTTCTTACGTGAGGAGATGCAGA
CACGTCGTAACTTTCAGGTGCTCCAGGCATACCTGAACCGGTTTCTGAAGCTGCACGAAGAGCTGTTGGTCGCGGACTCGACATTGCTGGCGCGGGTGGA
CGAACTGGGAGCCGTGCAGCAGCAGCAGTGGCAACACTTGCAGAAGTTGCTGCACAACAATTTGTGTCTGGTGCAGTATCTCAGTAAGATCCAGATGTAG
GTTCGCAGTTGCTAGTTTTACACATATACCCACAAGACGAAGCGTCAATAAACGACACCAATGCACTTTTGATTAGACTAGAGATTGGTTGGGCGTGGAA
AGGAGTTACTACTGCGGATGTACTCGCTG