Description :
From Genome Similarity Track
Location :
scaffold_12:301109- 303255
Sequence
2146 bases(100 bases per row)
tgtcatatataaaaaatagtGTAAAACCAGTGGATAAATGAACCGAATTGTTCATACCAAACTCTAATAATGGTAACATTGAAATCCATATTGTGAAATT
TGAAACTTTTCAATACATTACTGACCACTCGGTTAGCACCTTAGTTTGCCCGCTGAGGGCATATCCAAGCAAGTGCCAGGAattcaaaacaatttttttt
gaagaagccacTCGTGAATCGTATTTCACGATCAGagacgatggcgtctggcAAACCGTGTTTGCAAATAATATGATTCGTCAAGAATCTAGCCAATCCT
TCGGCACCGATGAATTTCTACATGGAGCTATGCAGATCATCTTTCCGTTTTGTCGATGATTAAGATCACTCCATTGTGACCATCATCATTGTCAGGAAAA
CCGACGATAAGCTCGAGACTGACTGACATCTAACAGTCAGTACTGAAAGGGATGGCACTTACATGTGTCGTCTGCTTTGCATGTGCTAATAGGCAAGGAa
tgtcttcacgtatcgTGCAGCCCACATGTACATGCGGGGCTACCAAATTTGGGCACGAAGAGACAGGTGGGTCTTCTTACGGCCAAAGGGACCGGCCACC
GGCATATCATGCGCCTTGTACATGATCTTGAACTTCAAATCATAGTTGTGGAGAATACCAATTCGTGGCTCGTCGTCATGTGCAGCTTCTTAGTGAGCCA
GACCATCCTTTCAATCCATAACGATGCATCCATGATTTCAAACGACCAGAAGCTTGTCAGGGAATTCCATATCACTCGATGAGAGTGCCTTGATGATAAG
ATTACCCCTGTCATCGCCAACATACGCTGAATTATTATATCAAATTAATCGGTTTCGATACAACTAATATGACCTGGCTCATAACGTGACAGTGCGTCTA
CCGGCATGTTCAGTTTTCCAGGTTTGAAGGCGACCGcgaagttgtattctgcaaagaatgacaatCAGCGGGCTATCGCTGTAACAAGTGAAGAGACTGA
ATTGCATATCGTAAGATTGTGTGATCTGCGAAGACGACAAACGGAGTCGAGCCCAAGAGGTGAACACAAAACTTCATAAGGGCGAACTTCAATGCCAAGa
gctccttgtcgtgaaccgTGGTTCTTTCATGCTATCTTTTGCTGTCACGATTGAAACGTcacgatcgtgtcttccTGAGTTCATTTGCAATAGTGCACAA
tcgattgcaaactcagaGGCATCACACACTATGCTATACGGCTTTATATACTCCGGAAAAGCACCATCAAACCGCTCTTGATTTAAGCGAATTCCTCTTC
ACAAGTGGATAACCAATCCCATGATacgtccttcttcagcaagtttaATAGCGGGCGTACCATTTCGGCGTAGTAATGCGACAAGCGAGGCAGATAATTG
AACGAACCAAGAAACTCCTAAAATCATTTTGTTTCCGTGGCATTGGAAGCTAAACGATTACTTGGACTCGAGCAGGGTCTGCACAAACACCGTGTTCACC
ATCATAACAATCGTGGACCGTTGCTTCGTTGGCACCGAAAATTCACGTTACAAGATGTGCTTCCAACGAATGCAAACGTATACATTATAGCATCACACGG
TGGTCCTTCAAGGAAATTGCTTTGGcaactttgccatcttcgTCCGTCGGATGATTTGTCATAATTTGTTTGTGCGAAGCTTGATACCGGTATAAAAAGA
TGGGAGACCAGTCGATTATACATTGATAGGACATTAAGAAGTTCTTGTGacatcacaagccactccgATAAAAGGCAAGACAGTGTATGAACATCGGTCA
AAGGGACGTATTCCTCCCTCATCACGATTTGGTtatatccatcgaccaaatccTGCAAGCTAAATTGTGTGCAGCCGGTCACACGGTATTTTTAAGCAGA
ATTGACGTTTGCCCGGGATTCGTCTGCGCTTTCAAGTTGTAACAGGCGTGAATGATACGCCATTTAGCACTTATTTCTCACACACAAACGTCGGCGTGCT
GAAATTGTGCTTGCTCTCTCTCATCAAACCAGCAGCTTgtttttgagcaaagaacTCATCAATATACTCACTTTGCTCACTTGACAGTGACCACTGTCGA
AGCGCTGCATGCTTTGAACCTGGTTCACGATCAATTTGGTGTAGAA