Description :
From Genome Similarity Track
Location :
Scaffold_131:3011- 4411
Transcript NameFunction/comments
Phyci_242416Hypothetical protein
Phyci_242305Hypothetical protein

Sequence
1400 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNCTCTGTGATCTCTATGTCTGCTCTCCACGCATATACCAGTTGCGTGTGTTTTCGCTGCGAATCGGCAAAGGAACCTCC
GTTTAATCAGGGCAGACCACTCGACGTATATATTGGCTTGCGTGGCTCGCTGTTATCCTCGAGTGCATTGCTGATTTTGCTTTGGTGTCGAATAAATCGA
CGAGTTCCTCGTCATTGGCCGTGCTCACCTTCATGGTGCCGTGTACTCCTAGTAGAAGATAACCCAATGGAATGCAATAACAACAATGCAACTACTGATT
ATCTTCACATTGATGCAGCGTCTCCGGTGTCTGACAGCTGCGAGAGCCTCCGCAGCGCAATGAACAGCGGCGGCTGATTGCGCTGGGCGATGCGTGCGTC
AGGAAGGTTTCGAAGCTGCTGCCTTCAATACCTGTACGCTGCTGGATTGCTGAAGCTGCTGACTGCTGTAGGGCGACATGGTCCAAGCTATCAAGTACTT
TACCGAGTCGTTCGTAGCCGTGAGGGACCTGCTCACGCCGGAAGCGACGATCTCTGGCGCCTGCAAGTACGCCATGCTCTGCGAGAGTTTGAACCAGCAT
GAGGATGCGCTGTCATTCTATCAGGCAGCTATGAAGAGTCTCAAGGCAGTGAACCCCATCAGCGTCCGCTGCGTCGTCGGCATAAAGCTCATGGACCAGA
TGGGGAAATGTTACCACCACCTGTACGTGGTTGTGTTGACAATGAGCTGTGAGGTTGTTGGTGTAGTTGTATTCACTTCATGTCGTTTTGTGCTGGGTTT
TATGGATAGAGGGCGGCACGAACCGGCAGAGAAGCTCTTCAAGAAGGCCGTCCGTCTGTACGAGAAGTACCATGGCGGATGGTGTCCTTGCAGCGAGACA
GCGAGGTGTCCTTCATGCGTCAGCGCCTAGTTGACCTGCTGCGCAGTTCACCGTCCATGCGAAGCCTCGAAACAACCACACTGGACAAGTTCGACGACTT
GATGGCTCTGCAGTCGATGCGAGAGGAGAACCGCCGCGAATGAGAATAATACGGCGCGTGGTTCTAGGCAGGCAGGTGGTCCATTAGTGTAATGAACAGT
GCCAACGGCAGATCCCTGTGGTGTGGCCGGTATCGACTTGCGACGCGAAAAAAACGTACGTGTGCTGTTACACTCACCTCTCAAATCGTGAACAGGATGT
TGCGAGCGATGGCGACGAAGAGGGGGCTTGTGCTTCCTAGACTGATACAGGGAGCTCCGAAGCTGGTGTCACCTCACGCTATCCCGGTTACTTGGGTGAC
CCCGATCAGGACGTTGTCCAATACGACCAGGTCCGACGGGTTCTACGTGAGCAAGAGGACCGTGAAGACGACGCTACTGCTCGGCGCAGCGCTAGCCGGC