Description :
From Genome Similarity Track
Location :
scaffold_1131:3010- 4286
Sequence
1276 bases(100 bases per row)
GTGGTGATATCATTTCGCGATATAATTTTTGGTTTCAATGCGGTCCAGTCTGAGTATTGCAGTGAATTGATCCAGTGCGTCGACACACGATGTGAGCAAT
GTGAACAGCCCCTTTTCATGCTGATCTTCTTATTAAACCCTGCCACTGCAGACGAGTGCCGGTCTCTAATTGAAAGCACTGAGCAACGGAAGCAAGCTGT
CGAGGTGGAGGAAAGACTTGCTGGTAGCGCGCTACATGAGCGCGTCCGTACTGAAGAGGAAATACAACGACTCCAACATTGCAAAACAGCTGCCAAAATT
GCATCGTTAACACAATCGCAAACTTTGCTGTGTATTACTATCGCCGCCTAATTGGTGACGACTATGAGTGCATTCGCGGTGAACTTATGGACTGGATTGA
GAACTCGCTGACGTCAGCTCATCCAAGAGAGCTCCGGTTTGATACGAACAAGTTTTGGCAGCACGTGAAAAAGGAGAACACGTCAAGTAAATTACCGGGC
ATGGCAATCAGACTACTCTCAATTGCAGTGAAAACTGCGACAACCGAAAGTTTTTCAGTGTACTGGCATAATTAATACGGCTAAACGTAATAAGATGACT
TCCCAAAATGTCAAAGATAATCAGATTATTCGCCAATTCACGCGGGGAGGTGATAAAAAGTCAACTAGACGTGAATCCATGATATCTAGAATTTTAGATC
CAAACGAGCACCCACTCATAGACTCGATTGATGCAATGCCCCTCCGTACGAGTCGCCAGGCAGGTGTAGAACTCAACACGAGCTTCCGACACCGACACCC
GCCGCTGGATGCCGTCCTCCGAGAACCCCGCAGTTTCTGTCTGTGACGAACACAACTTGTCATGGAACCCCTTCGCCGCAAGTGACCTTCGCCGATCCCA
ACTCCACAAGTGTCATAGCACCAGGCTGCGACTGAAAAGGCGGCCGAAGAAGACGATCTGGAAGATACAGGAGACATGGTTGACGGGGAGAGAGTTTTCC
TCACTGGACCGAGTACCTCGCTGGTGTCTTTGAAGATGATGAAATAGGCAAAGAGTTGTCTGCATCAAACCGTGACGATTCGTATCACAATTGGGAATTC
GAACCAATTCCAGAAGCCGACAATAAACCGTTTCCAGACATTGACGACTTTAGCTTTTCGCAGAAGAAGAAGATCCATGGTATTCGCGCCCTCAAGTCGC
CGCTCCTTGATCTTTTCCCCACGACCTAAGCAATTAATTGAACTGTCGTTTTTGTTCGTATCGTGAGTTGCTTCCT