Description :
From Genome Similarity Track
Location :
Scaffold_1178:301- 2342
Sequence
2041 bases(100 bases per row)
ACGATCCCTCTGCAGGATCTTTCGCGGAGTTGGGTATGAAGGCCGATCCACCAAGGGGCCAGTTGGCCTCGCCGGGGCCTCCCCTTCTCCGAGCGATTCA
ATCTCGATAGTCGCCTCGTACGCCAGATTCTGCCATTCTCTGTAACGACGGGATCCCACTGACACATATCCAGGTCGCCTTGGGATACCGGCCTTCGCCA
ACCATCGTCCGATGTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCCTGGATTACGGT
AGGCACCCATTTCTCGCCCCGACTGACCCACAGTTTCTCATGTTCCACCCACTTTATCCGATCTGGCAGCTCCCAGGTTTCTCCGGGCTCGATCCAGGTA
CTCTTATCCGCCCTTATGATCCTCATCTTCGCCCCGTACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCG
CCAGATCCAACCTCACTCCGGCTGGTACCATGAAATCCATCCCGAGGATGGCGTATTGACCAGCGAGATCGCCAACCCAAATATCAAATCAGTACACCAA
ACAACCTGTTAACGTGATCTTGATCCGCGTTCTCCCGTTCGTACGGTACACGCCTTCACCAATCCCAGCACAATCTTGGATCCGACTCCCATCCACTTGG
CACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCCCCACTATCTAGGAGTAGGATCGCTTTTTCATTGTTGATCTTGCCCCTACCTT
GGCTTGTCTGAACCACTTTCCTGGAGCATGGTATTTCCAGTATCCACGGGACTCTTCTGTTAGCAGATCCATGGATCTAACATCCTCCGATCTACGGGAT
CCAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGGGCCT
CTCCCCTTTGTAAATCCAGGGTTGAAGAGACTTCGGATCTGGCAAATTCATACACTTGGCGCAAACCAGAAATCTTGGCAACTGACACTTCATGTAGATC
ACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACC
GGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTTGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAGCCATTGGCGGATCTGGTT
GTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACAACCACGACACACGTAGAAGCAACGATCTCCAGGATGACCTTTCTTGCCGCAC
TTCTCACAGACCAGATGTTTCCAACATCCAGATTCCGTGTGCTTCCGGGATCCGCACTGCGAACACCTGATTTGAGCGGTCCCGTCCATGAGATCTCGGG
ATCTGTACATCCCACGGTCCCCGGGTACGGTATCCTCCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACCCGACG
GTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTC
GGAGCCTTTTGGCGATACTTGCCAGATCCGACCGCCACCTTCCTCTGGCGGTGTTTCGCGCGATGCACCGCCCGCAGCACTTCCTCAAGCTCGTCTGCGT
CGGGAAGTCGCAACAGGGCCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAATTGATCCACATGTTCCCGTAGTACCTTGGATCCCCCATC
CTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGACGCAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGT
GCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACT