Description :
From Genome Similarity Track
Location :
Scaffold_4036:301- 1599
Sequence
1298 bases(100 bases per row)
TCGACAAGGAACTCCCAGGCCACGCTGAGGCCGGCGTACGCGCCTGGCTATGGCTGTACTCTTCTTGAAGAGCCACTTGAATCGCCTCTTCAAGGGTGCT
TGACTGCACCCGGAACAGCTGAGCGCGTGCGGGGTCCACTCGAAGGCCGTCCATGAACACAGTCATCTTGATGTGTTCGTTGAGTGGGTTCCCCACTAGG
GACGCCGTGAGCTCCCATATCCCTTGCACGTACTCGTGCAGTTCACGCCTCCCTTGCTTACACGAGAGGAAGCGCGAACGCTGGCGGTACTCGCAGTTCG
CCGGGAGAACACGGCTCGGAGCTGCTCGCACAGCTGAGCCCAGGATGTGAAACATCCAGGGGATGTTGCTTCCCGTGTGTACACCCAACTCTTAGCACGG
GCCACTAAGGTTGGAGAGTGCAAAAGCAAGACGAAGTTGCTCGGTCGAGATCAGAGCCGCGTCCATCGCGAGCTCTACTCCTCGGACCCAGAAGTGAAGG
TTCTCGCCTTCTTTTCCCTCATACGGCTTAACCTTCAGCCGTATTGGCTTCGGGGTGAGGCAGATTTGCTTCCGCCGCCGGAGCCTGCAGTTCTCCCGCA
CATGCGCGATGAGGCCCTGCTCGTACGCGTCGAATGCAATTGACGCGCTCGAGCTGCTCGCCTGGTGTTGACACCACCGGCTTCTGCAGGCCTCCATCCC
GAAGATGCTTGCCATCTTCGAACCGACTCGAACTGAGAGTCGTTTCATATGGGAGAAGTCGTTCCTATCCCATGGCAACGAACTTCGGAGGTTCAGGTAG
TCTACCCCCGATGGCGTGGATTGACTACAAGTGCTACCAAGTGTGACGGGGTCACACAGCACCTTGCGCTAGAGGAAGTTATCTTCCGAGAGTATACAAA
CTCTCAGTGAACGGCAGTTCACAGGTCCCCTCTTTAATTAAAGAGAGCGAAGTGACCTAAATAAGGTAGATTGTAAACTGAGTATATTTATAGGTAGGTT
AAGTTTGTGGTTAATACAAACTATCAGTTACCTATAGAAATGCAATGTCATTTAACCAATGGTTGGTTTTGAATGACCTTGGTACCTTGTACCAAATATC
CCGGAGTATGACATGTCATACTCCTGAAGTGTGAAGTGTCACACTTCATGTAACCAGGGTACACTTAGTGCTACGTACCCCGTTACATCGCAGGTCAAGG
TAAATAGTGCTTTGTAATGGAGCCAGACACCGACACGCGTGCTATTTGTAGGGGTAAACACGACGTGCTATACAAAGCATAGCTAAATTTTGCTCCTA