Description :
From Genome Similarity Track
Location :
scaffold_1302:301- 1381
Sequence
1080 bases(100 bases per row)
AGCTTCGTATGCATACTTAGCAGATCATAACTTCCAATTCCAAGAAATCCAAGAAAATAGGGCCTGGCTTGCCATTCGCGTAGATTGTCCATGAAATTAC
TCGCCAACTGTACGTTCGTAAACATGGCATCCATTTCATCAATGCCAGCCACAGACGTTTCCCACGACGCACAAACATGTTTTCGGACTCTTCTGATGAC
CTTGTTTCTTCGCCAATGATTTTGCTGAGTGTAAGCCAAAATGTTTTCTCAGTTTTCACAGCTGATGGGGCTAACGAGCTGCATCTTACTAGCTCTAGCA
CGCTTCGCGCCTGTGCGTGCCCCGCTGAGCAACTATCCAGGTCTCACCTGGGTGGAGACGGTCTCATCTCCACGTTTTGTGGCGGTCTCCGGAAGGCTGG
CATCCGTTCTTGGCCCAGTATCGCGTTCTTGAGGAGCTCGAGTATGTTGATGGCCGCGTTCACGTCACGGTCCCAGTAGCGTGAACGTGGCCAACGAGCG
GTAGATGACTAAGGCAGACGGATGGAACGGAGTAAAATTCCATGGGACTGGACCTTGATAGACCACCTCTACTTGCGCAATTTTGACTCGCTTCGCGGGT
GGCAACTCCTCATTTCGTATCGTGACGCGATCTACGGTCGAGCTCTTCGGAATCACCACCAGTACGTGGATCTGACCGGTAGATAGCTAAGGCATCTTGT
TCTTATCAAACAGCCAGTATTGCAGAGTCTTGGTGGCTCTCATTTGCTCTCCTTCAATCAACATCTGAATGTCTGGGTGGATCTTTCCTTCCTTCAGCTC
CAGTGCAGTATCGCTTTCATCTGATAGCCACCCGTCTTCGCCAGGTAGAGCTGCAGCCTGTTAGGGTGTCAAATCAATCTTATGCTTCGCTGGTATCAGA
TCTGAGTAAGTAGTCTGCGACATTTTGTGTTTTGATTATTCTTTGAAAGCCTGTGAAAACGCATGTTAAGGGAAACGCACCAGTGTAGATTATAAACGAT
ATCAACTTTATAGAATCTTTGGAAATCAGTAAAATATTGTAATACTAAACTAATAGTTACAATAAAAATAACAATAAACA