Description :
From Genome Similarity Track
Location :
Scaffold_6:30099- 34506
Sequence
4407 bases(100 bases per row)
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncccccccccccgccgcatctgccgcaagactcacctcgagttgtcataat
gaccaagctcgcctcgcacgtagccttaccgttggacttcgttcacatcaaaagaaggcgcgtttactgcgactttggaacgaaacctgtcagtcagact
aagttctgcttgctgcctcaatagccgcgtactttcaagaagaagaatcccctcaacgtcatctacgtgtctcgtttaacttcaactctctctccgactc
ggattgcgttcccaagtttcgattcggaaaggctcaaattgagtcactagttattctctttgaattagacgcaatacggactcgcgaacgcacagcagca
aatggcgtagaaggactgtgtgttgtgctctataagttggcggtttcgattctattgagcgacctggaaggtggttttggtcgaaggtcgatggtatcat
caaacttgtttctacatgtactggagattatcgagctaaaggaatccggatgctgaacagagctgtcatgttttccgatcttttgttttttaaacgcgaa
tatgctgcacaaaacgttaaagtttatgctgacgcagtattcgaaggtggtggcctattgcaaaacgtttgggcttttgtagatggaactgttcgtggca
tttgtcgacctaaagcgcgtaacattttgcgtgatgggaagtaccggagtcaaatagctgcatacaacggtcataaacgcaagcatgcgcataagtacca
gaccatttcgactcctgacggactaatttcacatttgtatggcccgtttcctgcgcgaaaccacgacataaagatgttaaagagctcttaaatttcaagt
tctattcaaaatgatgagcgatttcggctatacagagtgtacggtgatcaagcttacggaaatgacggtgtattgacaagcccttttactggggcgattg
gaaatctgtctagggaccaaaggctagtgaacaaaagcatgagcagagtacgagtctctgtcgagtggggctatgggcaggtggtaaactactggacggc
tctagacttcaaacgccaagcacgatctagtacttagtcagtcggcaccatgtatggtgttgttgtgttgttgacgaattgcctaactcgcgccaatggg
ggtaatactattagtgactactttggtctgtctcccccaagtctagtaaagtacttgaaaagcaattaatgtattaaaaaatcgctgttaccctactgct
ttttacctccgttaaaagactcgctaaaacgtttgcaaaaactgcaaaatcagttgtctgttctgttcttcagattgctcacgtgctcgtgtcaagcgac
cgtcggctagttctctagctctctcacgctctcgctcaaactgcagtcgacttgcatgttgttcgcgttcaaatgccagtcgttcggcatgttgttgttc
ctgccacttcaattgacgctcgaattggtctcgacatatctccgcgtcgagtcgaatgcgcttttcttgtctgtcgacttccaactggatattactccta
cgacgagtagggctcatacaacaagtagagccggtgggttttgtagaggccgattgcgaaccggtagactgtgttaaagctactgaagcggtattgtggt
gtagtggactgcgaagcgacaccacgcgggttcactcacacacagaggggccggactgccaactaaaggagggggtactccgatcgaccgtggggtccga
agatcttcttaccttgtgtacccgttgacctggcggggttaacgctcttcttgggtgacctagaggagaccaaggttttgggttcttggttgagctggag
tgtggacggcactcaggtgtagtcggttgatggtcttctggatacttcttcacttgatcgtcggtaggcagaaaaggtcgaagcttgaatatacttgatc
cactctacatgttgtccttcgggcttgtgttgttccaaaggctggtcaatctgtttccgatgttaatgcttggaccgcctactgttagcggtggagttga
gggggggggggggggagagagaagcgtggacctggccaagctttccaggtgtcggtgcgtttcttgttcttgagcgtcttgatgttccttcgtcaagggg
ggccaatattggccaagggtttagggtttagccaatatacttcccagccttggaaacacggaaaaccacttgcgtgctacaaggaaatctctctctctgt
taaccatcttaaatctttcctatctgttccctttcctcccatcatctgcccatccccttcgcagctgactggctacgttgaacttcagccggtgtacccc
ttaatcggtgcatgtgaatcttaatcgacgctgatcgtgaagtgtaccgaaatgattgtacctggtcgatcagcattcttgatcgctgagacatacccga
atgattgcaccttgtcgatcagcattcttgatctcttcactttcctcccatcatctgcccatcttcttcgcagctgactgactacattgaagtttggccg
gtgtaccctttaactggtacatgtgattctcgatccagaagtgtgactaaaagattgaacaattgtctattcagtttgtagatcgcggtgacgtcacgaa
atgattgcgccatgtcgatctactcctcgatcgggataatgtatcgaaatgatagcacccttgtcgatctacttttggatcaccagacgtgtacctgaat
gattgcgccatatcgatctacttgattggtacccaaagttggtacctgattcgactcagtatcagatctgaatactgccacccaggccccatcaaatctc
tccacatccttctcgatcatgtctccatcgatcgctgacgaccgaccctctcgcttcaccacagtatcaccttcagtctccgatggcgaatcactagaga
gtaagccttctccacggagagctcgacgtgaaatagtttcgactacaatttcagaagcgcaaacgttagtctaggcttcttcagctttctttgttctctt
ctgttttttttcggtcgtaaattcactttccaatgccacgtattgcccgacaagacctgccaaagtatcataatgacttggtacatccgatgcgtcttct
gcttcttcgataccactactaaaactggctcggagctatcctgtgcgccattttttcttcaagagtaggactcgatcttgcacctgcttgtctatcagca
cgaagttgatggcggcactcacacacgttgcactttgtacccacacagtaccagcctcaccgtacttggctacgaacggtttctgcttgataacctctcg
aataagctccttgtccatgtcttcagagaacctaaaaaccatcgcacttgtttggctaaagaaacactaggtgagacctaacgtgagggctcggtatatg
gtctcaa