Description :
From Genome Similarity Track
Location :
Scaffold_212:30099- 32986
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_212-fgenesh-gene-0.7Peptidyl-tRNA hydrolase
Pytir_DAOMBR486maker-pir_contig_212-fgenesh-gene-0.13Calcineurin-like phosphoesterase

Sequence
2887 bases(100 bases per row)
AATGGAAGAGATCGCGTGGAAGTGCTCGGCGGCGTTCCTGCTCGGCGCCGCAACCCACTACCTCATCGCGCACCACTTGCAGAGCGACAGCAGCAGCCCT
GCGCATTTCACCCAGTCTTCTATTGAGTCATCTGAATCTGCGGACACGAAGCCAAAGGACGGAGACGCGCCGGCGCAGGATGGCGAGAACAATGACGAAG
AGGAGGAGTTCGAGTCGGACGACAGCGAGTGGGAGGACATGGACGAGAACGAGTGGCAGCCGCACAAGATGGTGCTTTGCGTGCGCACCGACCTCAAGAT
GGGCAAAGGTATGTGGTAGTGCGAGTAGCTCGTCGTGGTGCTGTCGCTATGATGTAGTAGTACGCATTTTATAGTGTGTGACGTAAATTGTCGTCATGTG
TTTGTTCACAGGTAAAATCGCTGCGCAGTGCTGCCACGCGACGCTCGGTGCCTACAAGCGCGCGTTGAAGCGAGCGCCGAAGGCCGTGAAGGCGTGGGAG
ATGCTCGGCCAGGCGAAGGTGTGTCTGAAAGTGGACTCGGAAGAAGAGCTCTTGAGTCTCGCGGCCAAGGCGTCCGCGCACGGACTCATCAACTACGTCG
TGGTGCGTGCTCATACATTGAATATGCTGAGTTGGAATGGGTATACTGTGGGAATTCATATGCTAATTGATTGTGTGGCTATCGATTATTACTAAACATA
GGTCGACGCTGGACGAACGCAGATCGCCCCGGACTCGAAGACGGTCCTGGGCATCGGTCCAGCGCCGATTGAAGCCATCAACGACGTCACAGGCCACCTC
AAGCTCATGTAACAAGCCCACCAGCCGTGCCTCGTGCTTTGCGTGCAATGCTTACACCTGGGACGATGACTGTCCGCTGGCGTAACAAAGATGGATGCTC
ACATGGTGCAGAAGGATGGATACACTGGTGGGGAATGAAATGGATGGATGAATGGATGCCCTCTATAGACAACAGACAGGAAACGAACAAACACTCTTTA
CCACAATCAGACCCTTCGTTCCCAGCCGCATATGCATGGACGGGACGGAAGAGACGCTTCTTGGTCGTCGCTGTATTAACAGTATCGAATACAGAAGTTC
CTGCCCGTGCCTCTTGAACAAGCTAGCCATGTCCGTCGCACTCGTTTGTGCTTACAACATTGGAAAGAAGTTTTCCTTCTCTCTATCGCGGTACTCCGAG
GTCTCCAGCACGCCGCTGCGCTTCAGTCCGTGCATCACCGCGAACACAAGACCGAGCACCACCACTGTCGCAATCACGGTCATGACGATCGCTATGTACA
CGTCCGAAGGCGCGAGCGTGTAGTGCGCGCTTGTGCCAGCAGCTCCAGTGCCAGCACCGCCACCACCAGCACCGCCTTTATTAATAATAGTGTTTACGAG
GCTCGACGTGGAGGTTGCGCCATCGACGCACGCCAGGAACTCGCCCTTGGTCGTCCACCACTTGAGCGAGCACATGGTCTTGGCACGGCAGAGATCGGTC
ACGCACGGCGGCGTACGGTGCGACTGCGCCTTCATGTTCCAGTAGTACTCCTCGAGGAGCGCTGGGTCGGCTTCAACGCGCTGGTAAAAGTCCGTCAGTG
CCAAGTTTGACAGTGACTTCAAACCGTAGGCTCTGTTAGGAGATAGCAAGATAATATACCGGCATTAGTGGCGGACCCAAGACAGTTTGGAGACCCTTAA
ATTGCATGTTCACTTACTCGCTTGCTGTGAAGAGCAGCTGCCAGTCCAGCTTCTGGTCGACCTCCGAGATGTTGGTGCCGTAAACCACATAGTCGAGTAC
GTCATAAGTCTCGGCATCGTAATCCCAGACCATGAACGACGGGTTGTTGCCAAAAAGCGGCGAGATCGAACCGGAGACAAAGAGCGGCACGAGCTCAAAG
CCAGTGGCAGAAGCGTCCAGGCTCACGGACGGCACGCGGAACTCGACGCTGTGAACGTGGCCAAACATCTGCGCCTTGATCACGCTCGCGTACTTGCCCA
CGATGCTCTTGTACGTGGCAATATAGTTGACATTCCACTGTGGGTTCCCGCCGTACGAGTCTACAATCGGCGCGATGTGCCCCGTGATGTACGCGAACTT
GCCCTGGTTTTGGAGACTCGCGAGCGTCGTATTTAGCCACGCAAACTGTCCAAACGGGTCTTCAATCCCTGATGTGTCAGGCAAATGGCTCGGCTAGAAT
ATCATCAAAGCACCAGCAACGTTAGACTAATTTCTTTCGAAAGTTGATGGCAGCAACGATAGCCTTGACGTACCGAGTAGGGTACCGTATTGAGCGTGAG
CACAGTGAGCTTCTCGTCGAGCTCGTACGTCAAGTAGCCGCGACGATTGAATGCCTCAAAGTCTTTTGACAAAAGCGATTCGCCCCAGATCTTGGAGATC
TTTTTAATCGACGGGTTCACGTGGCTGTTCGGGTTCGTCACCTCCATGTAGTAATCCGGGTCTGCATGAATAGCAAAGATGAACAAGTGAGCATCAGCTT
ATCGCAACTAGCCAATGACAATGAGAAGCGCACAGAGTCACACGACTTACTCCCATCTGCGTTCCCAATGATCGCAGTTGTCTCGAGCATCTCGCTGTCG
CGCGGCGAGTAGAATCTCTCGATGGTCTTGACATTCGTCTCAAGCGCCTTGGCGATGTACTCGTCCGAGAAGAGTCCGTGCGCGACGTGGTCGCCCGTGT
AGAGGAACAGGTCCGGGTGCGGCAGCACCTGCTGCGCGTACGTGAGCGCGGACTCGAGCAGACTCACGGGTGCATCCTGACCGTAGAGGTACGGAAACCC
CGCCGAGTCTTCCGCTTTGAACGACGCCGAGATGTTGAGGTGAACGTCCGAGAAGTGCAGGATCTTCTTCACGACGCGCCCAGAGGC