Description :
From Genome Similarity Track
Location :
contig_38:30097- 33071
Transcript NameFunction/comments
g7045.t1hypothetical protein

Sequence
2974 bases(100 bases per row)
ATGAGCAGGAATACCTGGAGCACACAACTGGCGGTGCTCGCTTCATTACTGGCGTGCGCAAGCTCCGGTTCCTGTTGATCGCTGTCGGCATGTACCTCAA
CATGATGTACAACGCGTACTTCGAGAGACCAAACAGGATCATCACATCTGACGACGATATGCTGACGTACGCTCTGTCTGGCCTCGTCATTGTGATCCTC
CTGCTGTTGATTTGCTGCGGTTACATCGCCAGTCGCGTGACCAAGAAGATGTCGATGAAGCAACGCAAGCTGCGCAAGATCAAATTCTTGTTGTCGTGCT
GCTGCTTCTTTATCTCCATGCTGAGCCTCACGGTGTTGTCTATCGGCAACCTATTCACTATCTTCGTTCTGCTGTTCGTGGCGGTCTACTGGTTCATGCA
GATTTGCATCCTGCGGCTGCAATACCACCACATCGTGGTGCGTGCGCTGGCGCGCGCCTTCGACCGCGCAGTTGGCTGGATTGTGTTTGGGCCCATTATG
ATCGTGTCGATGTTCCTGCCATTCATCTCCTCCTTCCAACAGCGTGTCATGTTCAACAACGCCTTCACCTCGGGTCTCGAGGTATCGAAGCTCTTCGCGC
ACGACGTGGCACCGGCAACAGGTTGTCAAGGTCAAGCGTGTTTCGAAGAAGAAGAAAAGCCGCGACGACTAAGCGAAACCATTTGCTAGGACTTCTCTGT
TGAGTTGATCGGTCAGCCAGTCTTGCTATTTTGTATCTTCATAGAAAACAAAACATTTTGTTCTCGACTGCTTTCAACGCGTCTTCTGTTCTCTACATGA
AATGCGAAGATTAGATAAGGGTGGCTAGTGATCAACTTCTTCTAACCTTGCATTCGGGTGAGGTCCGGGGTTGAAACAACATGACGCATGCCAACGAGCT
CTGCAGCCGAACGACTGTTCATCCCACTGTGAGGACTCACGACATTCCTTTGGGCGAATGGAGCAAAGCTGCCCGACGCACTCAAAGGAGATCGAGCGTT
GTTGACGTGAGGTGGAGAGCCAATCTTGAGTTTGTCCAGAATCTCGGAAAACTTCTGTGTGTCCGGCTGGAAGCGCTTCAGATCCAATTTTCGCCGAGAG
TCTCCTGCCCCATTCGTTTTCCGAGGACCTGAACTCGAACCACTCCCACTATACTTGAGCTCTATGGAAGACCGCGAGCGCACGGTGGGCATCGTCAATT
CTTGCGAAGGTGACGAAGTGTCGCTGCCAAAATCGTCATCTTCTCTAAAATCTCCAGATAGTGGCTCGGTATCACTTTCAAGAGATGACATCGTGTTACT
CCTGCGGCGGGCTCCGTTTTCGTCTTCTTCGGCCGACAGACGCGAGCTTCGACTACCTGAGTCACTCTTTGGAGCAGCGGTTACCACGTTGGATGCACCA
GCTGTCATCTCTCGCATGCGCATCACGTCAAACTCTTCGGCGTCAACTTCATTGTCAATTTCAATCGCCATTGCGCTTTCAGTATTTCCTCGCGACATCT
GGGTAGCCAGGCTCTGGATGGCATCTTCTATCGCGTGCATCCACTGCTCCTGACGCCCCCACGTGTCTGTAAGCACAATAAAATTCTTGTATCCCTTTGA
CGAAAACTGCAACCCGTGTGCACCACTTCCGGGGCCTTCTGTCACGCCGAAGCTGTACCACTTGCGAACGGATGTGGGGATAACCCACTTCATACGGTTT
GTCCAGTTGGCGCTTTGAAGCGTATCACAGTACCAGAGCTTATCGCATACTTGGCACAGCCCAAAGAATGTGATGGTAAACGTGAGGGCATGGAATGGCA
TTGGCACTGGGAACTGGATAAATGAGCTCACACGCGTGGGTTCCGGTATAGGAATATGATCGTGAATCTTGTCCTTCTTGTACATGAATCCAGTGATGAA
CTCGTCCGTATACGTGACCTTGCAGTAGTGGCTTGCTGCGCCAGAGAAAATGGTCTCCAAATAGCCTGTGTATTCGTCCACATCTGCATTGGTGAGCGTG
GCCGACACGTATTCGACTGCACTCTGCTTCAGCTTTAAACACCCATGACAGAGCGGCGCGTTACGCTCACCGAGCGGCAGCATCTCGACACGGTTCTGCT
CGGCAAGAGTTTGCTCGAACTTTACCCACTTTTGGTGCTGTGATGTATACTGCCGCACGACATCTTGACACGTTATCGCAACTGATCCGCTTCTGCAATT
CGGGGTGCTGCAGCAATAGAAACGTTTTTGTTAGTGCACGCACGGGAATCTCAATATACCACACACAGTAGGTACGTACTTGGTCAGTGTGAAGATACTG
TTTGCAATAGTGGTCATGTGACCCTTGTACTGTACGTGCTCTTCGTATGCACGGATGACAAAATCCAAAATGTTAGCCCCTTCGATGAAGAGGCTATTCA
GCAAGGGCGACGAAGGCAACCGCTTTTGATCAGGATCCAACAAAACAAACCGAATGACGTCCGTAAGTTCGTGATGCAGCATGCTGTTGCTGGGGTGCGA
TCCATAGCACGCCAGCAAGCATGGCATTAAACCAAAATTGGCCAAGAAGTAATCAACATCTCCACTTTGCAACAGAACGCAGCGCTTGAGAAATGTGATA
ATGTGCAGAAGAGCAGACCCTTTGGTATTAACCGCCTTGATACTTCCTGGATTATAAGAAGTTGACATTGTGCGAAGCTCGTTGACGTCCGACGTCACCA
CCGCTCGACACAGTTTCACAAATTTCTCCACGCGCGGGATTAAGGCACTCAGTACCGACACATAGACCGTTTTCAAAAGACCTTCGATACCTGTGACATC
GCGCTTCTTCTTGTGATACCCCAATGTTCCCATCAGCATCATGACAATCGACAGAGAGCCACCTTCACGGACAACGAGAGACTTACACCCTTGAGTACAC
TGACGGCAAACCTCCGCAAACCCCAAATCAATCAGTGTACCAAACGAAACATCCGACGTATTGAGCAGAAAAAT