Description :
From Genome Similarity Track
Location :
scaffold_668:3009- 4719
Transcript NameFunction/comments
g9780.t1hypothetical protein

Sequence
1710 bases(100 bases per row)
CCATGCACTCTGAGCTGGAGTAACCTCTCGTACACAGTCAACACCAAGAAGAATGGGAAGAAGACAATCCTAACCGAAGTTACGGGCCGCTGTGCCCCTG
GAGAACTAACAGCAGTCATGGGCCCGTCCGGATCCGGGAAAACGACTCTTCTAGACATCCTAGCGGACCGCATCAGCTCTGGAACGATCTCCGGTGATAT
CTTTCTCAATGGCGAGAAGCGCAACCTTAAAATCTTCCGAGCCGTGTCGAGTTACGTCGCCCAAGAAGATTCTTTACTGGGCTCCTTTACCGTCCGCGAA
ACCCTCGAAATGGCTGCAAAACTGAGTCTACCAAGCTCCATTGGCCACAGTGAAGTGGTTGAACGCGTACAAACCGTCATTGAAGAGATGGGGTTACGCG
TTTGTGAGCACACTTTAGTGGGGGACATTTTCCGCAAGGGGATCTCCGGCGGACAGAAGAGAAGACTCAGTATCGCTATAGAACTCCTATCTGAGCCTTC
AATCCTTCTCCTGGACGAACCAACGTCAGGACTCGACTCTGCGTCCACTTACAACGTCATGAAGTTCGTTTCCCGACTGTGCAGCGAGAAACTGACCGTC
ATCTGCACCATTCATCAACCTTCTTCTCTGGTTTACGACATGTTCACAAACGTCGTCATCTTAACTGCCGGCCAGACGGTTTATTTCGGTCCTCGAGTGG
ATATGTTGCCTCATTTCGCTTCTTTAAACTACGTCTGCCCGGAACACGAAGACCCAGCGGAACACTACATCAGTATCGCCAATACGGACTTCGAAGGCCA
TGGAGATATCCCTCAGCTCGTATCCGGATACGCTACCAGTCCGATAGCTATTCGTATAAAAGACGCCATTCAAGTGGATTCCACCGGTTTACACGCTTCT
AGAGCCATCGAACGAGTTCCGAACTCCCCACTACGTCAACTCGTCGTGTTACTGAAGCGTAACCTGCTGGATAACCTGCGTAACCCGGGCATCTTCTGGG
TTCGGCTCGTCATGTACACAGCGCTGTCATTCATGATGGGGACGATGTTCCTCTCTTCTAACAAACGCATCACCCCTCACGATGTCGTTTACCTCCTGAC
GTACGCGAACTGCTTCCTCGTGTTCATGTCAATCGCTGTTCTACCGTTTTTCATCGAGCAACGGTCGGTTTTCCTTCGAGAAAGAGCGAACAGCAACCTC
AACGTCTTCAGCTACGTCCTCGCCAACTTCTTAGGCGCTTTACCAGGGATTTTCCTCATCGCTTTGAGCTCTACGTTGCTTGTCGGGTATCTGGCGGGTC
TCAATTCGTACGGGATTTTCCTATTGATCGTCTTCTTGTCGCTTGTGGTCGCTGAGAGTTTGATGCACCTGGTGGCCGCTTGTGTCTCGCACTTTATCAT
CGGAATGGCAGTGGGAGCAGCTCTTTTCGGCTGGTTCATCCTCTGTATGGGGTTATTCGTGCCTCGACCTGCAATTCCAGACTACTGGATCTGGGGCCAC
TATTTGGGCTTCCTGTCGTACGGCTTTGAGGCGCTCATGCACAACCAGTTCCACGATGATACGTCACCTGCAGCTCAGTTGATTCTGAATCGGTTTGGAA
TGGAGAAAGCAGATCTTGGACGAGATTTGAGTATTGTGGCAGCAAATGCGGTGGCGTTCGAGATGATGTTCACCTTCGTATTGTACAAATTCCACACTGG
AAGGCGTTGA