Description :
From Genome Similarity Track
Location :
scaffold_2:300853- 306213
Transcript NameFunction/comments
Plaha_PHALS_06577mitochondrial carrier family
Plaha_PHALS_06578hypothetical protein

Sequence
5360 bases(100 bases per row)
AGCTGCGAAAATTCGTTCGCGAGCGATTCGTGTGGGTACTGCCAAGCCAGCGTTAAAGAATCTCGTGGGATCATCTTCGTATAATGCATCAAGACTGCCT
AAAACATACTGTTCTGCAGCTTACGTACAGCGACATCATATCCGCGGCTAAGCACTACTCGAGCTACAAGTGGCCGTAATTTGACGCCTGTGAGCGCTGC
TTCAAGCAGAAAGAGTTCATCCTCAGGTGATTTGGCGTCTGGTGTCAGCCATGGAGCACGCACCACGACGCCATTGTGGTCCCACTGCGTCTGACCGAAA
AACTTGGCACAGACGCAGATTGCACCGCCATAAGGTCCCATGGACACGCATGAGCGATTAAATAGAATAACGTCACCTGTATCAACTTTAAGATCACGTA
ACAGCTGGCGTATAAGAACTTCCTCTTCGACAGCAGCGTCCTGGACATCACTTGGTCGTTTACGAGTCGGAGTTGTAAAGGCCATATCTGACACAAGAAA
TCCAGAGAATTTCGACAACTAAAAGTCGGATGGAATATACATGCTACTGTAGTTTAACTGACTAGTATTTANNNNNNNNNNACTCAAGCATGGCCCCAAG
TGGCACAAACAGCCGTGGTAaaacacgcgctcagtctgctNNNNNNNNNNGTTTTACcaagcatatcgcgtgcgagcgcgtttccttgccgcccgacagg
gcaacaaggaatcggtggactttgtcaaggaaatgcgtactctcattgtgGGACGGCaacagatccccttccggaggcggtcacagtaaccgtctttatg
gaaggcctccgcactggcgtggccagaatggaagtctttcgtgtggatccatcttcatttgaaaaggCAGTAATGTGgcgttgaatgccgaattcaattt
caagtcggcacgacttggttggaatgcacNNNNNNNNNNCCTGTGCCAATGAATCTCAGCtgtgctgaggacgagggagcagagttccgagctgctgcgc
agcacacaaacacacgacggtattttgtctgtggagacacccgtcaccttcggaacagttccccttgcgcaaggcgcgtcaaggttcgtcgaaccatcac
accaatgcctaccagtctggttcgtcgcgctgaaacgacaccacccagttgacgcggggcgacctactggggatgAACTgaattctgttgagcctcaggg
aggcataggtcaacaagGCTcatcccgaagagctccgtgctcttgaacactgaacgtgtatgcaagccgggcttgttggttgtggaggcgaccataaagg
gcttcgagaagccatggaagatcctcatcgattccggggtgtcaggcaattatgttctacgctccacgatggaaggtagtcagctgtatgctgaggcgct
aaaagcgcggttgggtgacatcgtcactgttcgcctagcgacgggacacgtgtcacggttccGAAGGTACCTGTTGACCTCGGAGtccagtttcttgact
ttgatagcgtggaacgctgtctagtcttagacttggatgcaaggtaNNNNNNNNNNGTTATCCTTGTTATGGAATGGTTGGAAGACCATGAGCCATgcat
tgattggaggtcaaagatcttGGGCGCTGCGCGCActtctcctggtggagctttggcgagccATGAagtagaagcgctattggcgtgggCATTGAACCGA
AACAGTCAATGTGcctgtcaaacaccgaaggtgtattagacaagagtcccaagcgtggctcgcgggctgatcatggagtagcacgtaaccAACTGAGCGC
TACTCAGgtattgaagcagtcgctgcacgccaagagtggcatggtcggccttGGGCCGAGGCTTCAATCGCGACACCCTTGGGATGCACGTGtaatggca
cgtaacccactaagcactgcttacgttacgaagcagttgctattACCAAGAagggcatggtcggacgaggtccaaggcaCCGAGGGCGATTCGAAgtggt
tgctgcatgccaagagtggcatggatgaacgaggtccgaggcatcttgagcaaggcccttctgatgagcgtggagtggcacattatccactggatgaagt
ctgcagaaatagcagctcatcgtcggatgttgtcaatTGCATTAaagctccgatggagcaaggagtgaagacactggacgacaccgagtgcgtgttccta
cCTCTATgaagcggcaaagccgtatgttatctgcatgaCGCAAGGCGTCGCCCTGAcctagggtgtgtctaccgtagaagATAGAGCatagctatacacc
cttgttaaCGGtttgacgggagaggaagacggcaacgtcacCATCGAGACTATTCccacggtggatgctctttttgagctggacgagatgtcctcgaaga
gtttggcggcgcCTTAAAGGCAGACAATTTAgctgaggtggtcattataagaccggagattaactcgtcaatgcttctggatgaagctatactagggtgc
tgaacgcacgaagtggatcaatGATCCTGAAGAACTCCTCGGATCGGACCCGCAGTCGTCTTATCCGTTCCAGACAAGCAAAAAACTCGACCTAACCCAG
CGTGTCTACTTGTCATAACGGTAGATAATCAATAACATGGACTGTGTCTTCACGACAATTTAATCTTGACATTCGGTCGTCGTATTGACACCACGTCACA
CCAAATTAAGATCAGTGTTTATTGACTGCAGATCTTAACGGCAGTGGCAAGCTACCGACACATGCAGCGGTTGTTTAGCAACATACATGTTTCACACATG
CGAACATGAGTTCTTATTTATGCTTGCAGCTTCAGCCACCAGTACAGTTCCGTAATAATTTTGTTTTTACATATAGAAGCATGTTCTTCGTGCGGTATCG
TGTACTTGGGATAACCATGACGAGGTATCGCCTTCGGCTGAGTTTCATGATGTGAAATAATGAATAACGGTGCAAATATGCAACCATGCGATTTATTGAA
TCGAAATTTGAGCTAACGAACTTATGCTTCCCAAAGACTTTTCCCAACGCAATACATCAAGAGCATCGCCAACACCGAAAAATGCGAGTCTTTATATTTG
AATAGACTTGAAAGTGTATCCATCACCTTATTATCAACCAGGGTTTTGTACAGTCGTAAAATTTTATCCGATGAAAAGAATTACGTTCTTAGTCCTTGTG
AGAAATACGGTGACGAAATCACTATGCGCAACGACGCATAATTTAAACAGATCCCATATCGCACACAACCAAAGCACATGTTGTACTTTGAGCTGGCAAG
TAGCCCTTATAGCGAGTTGTAAGATTTTACTTTTTCGATTCGGACGAACGGGGCTCAAACGCGGTCGCAATTTAATGTCGAATGGTGTCTACTTGGTAAA
AAGTACAGTGACGACGGTTCGGGCATCAAAGACGAAAGAGAATGGAAGGGTCGGAGTTGAGGTGCCCATTTTGTTTTCATTCACATCTCAAAATCTGCCT
GTTCTACCGCGTCTAAGCACCTTTTGCCATCCCTATTGACAATTAGACAAGGTCCAATCGATGTTGGTATAGTTAGGACCATTCTTAAGCAGGTAGTTAG
GCAGGCCAAGCCTCATTCTTTCACCCTTAGCACTGAACAGACCTATCTGTGGTTTGGACATACTTTCCAGCAAAGCCATCTACTTTAGGCGCCAAATACG
CACTTCCACATATTTATTAGCAATGTGTGTAAGTGCGTATACACAGGCATAGCGTACATGTGGCTCTCTATATCCGACTCGCCATGACCTGCACGTTTAA
GACTGACAACTCGCCAAAATAGAGGTTTGTGCATTGTTTGGTACAACCGAAATAGCTGTATCAGCAGACAATTGTAGTTTGTTGGAGCGTTTTACAGGCA
TTTTGGAGTAAGTTACCACTTCCACTGCATCCCGCTTTGAGTATTCATGTGGCCGGCTACTACTGCAGTAAGAGCCAAACGCATCATTCATAATGAATCA
TTCAGTCGCCAAACTCACCTGCAGAACTCTGAGCGTCCCTCAGGATCCTACAGATTCATTTATCCATTTTTGAATGAATATAACGACGTTGTGACAAAAG
CCTCCCATGAATGTTGCTGCCGAATGTTGAAACAAATTGACTTTTCGGAATTAAATGTTGTGTCGTACGTCCATGATCTCAACCAAGAAAAAAGTCAGAT
TTCATAGACGCTTTATTTCATGCAAAACTCGAAGCCAGGTTTGGTAAGCGACATTAAAGTGTTCCACTTAACGTCGTCTTTCCGTGCTAAAAAGGCCCAT
GTCGGGTGAAAAATTGTGCACGCTAACAACTAGCTAAATGCAGCCACTGTTTCGGCGCTAACTCCTATTGCAAAAAAACGCTGTACCGCAAAGCAACATA
GTATGTTGCACCAATGTTCGGCACTCTTGGCCAGGTGGATGAGTCTTATCACCTACTCCATGGAAAGAATGATATACTGTTCAAACTTCTAGCGGGGTGA
TCTGGATATGGCTCATTATTTTCCATGGACCGTTTAACGCACTAGTAATATCCAATCGTCGTGTGACACAGCTAAGTGCGCCATACTGTGCAATGTGTAC
CTAAGTTATTTTACGAGATATTTGTCTAAAGCGTGTAAAACATATGAAATCGGATGTGCCAATTTTTAGGTCAACGATTTGTGATCAGTGCTCAATTCAA
TGTGCCTCAAGAAGCTGTCTCCAATATTGACAAGGTTGTATTTGGCACCGACGAGACTCTTCTctcttagattttactacaaAGCACGGTCCCAAAAGTC
ATATCCTGCAAAGATCAGGATCAGTAAAGGCTAGCCAGTGCTGCAGTCCTAAAGAGATGCAGAAAATCTGCTCGACTCTTACAACTAGTTGATACCAGCA
TAGCATGGTCCCTCACCAATCATCGTAAATAAAGTTTGATGGTACCAGGTGTGCAAGAAGAGACGGCCTTTAAGGCAGTAAAAGAAAGTCATATGTTTGT
CTAGTTTTGGCTCATTCAAATATGGAACTGCTATTTCACATAGTCAATGACGCTTCAGCCTTTGCTGTAAGTTGTGCTTGAAGCCGATGCTTATGGGCAT
GTACACATCATTGCGTTTAAATTGTAACATTTTCGAGAGCTGCAGTGAAGGTCTACTAAGCTCAATATGGAGAGGCTTCCTGATATGACAAACGGAAATG
CCAGCTCCAAGGTTCGCCTTCTTGGCCTTTCGCTATTTGTAATCCAGATGTAGCATGTATTATTCTGCACAGTGACACCGTCGCCTACTGTTGATAGAAA
AGGTTGGTGTCAACAATCTTATAGCTAAGTCATTAACTTCTTCGGGGCAAAGATAACGCT