Description :
From Genome Similarity Track
Location :
scaffold_168:30085- 46890
Transcript NameFunction/comments
g4978.t1hypothetical protein
g4979.t1 tRNA pseudouridine synthase
g4980.t1 hypothetical protein PHYSODRAFT_320443

Sequence
16805 bases(100 bases per row)
TGATGGCGGTGAGAAGTAACGAGCGGCTGCATCGTAGTTTTCCACTGGGAGGCATCAATCATGCGCGTGGTGCCGGCCTCGGCGGTGTCGCGGCTGTCCA
GCCGCCGCCGGTCGTCGGTAACGCGAGTACCGAGTCGGATGACGATGCTTCTGCTGCGCCAACGCGGCCGGGCCGGCTCATCGGAGCTTTTGATGACTGA
GAACCACAACGCTTTCGACCCGAGCTCCCGCTTCATCCGGATCTGCCAGCAACTTCGACTTGCAGCGATTCTCTTTGAGCTTGTGGCGATCCCGTTCCTG
GCCGCGTTCCACCCCGAGGCTACGCAGTCTCAACTGATTGGCGTGTACGTGTGCGAACTCCTTTTCTGTGCAGATATCTACGTCCAGCTCAACACAGGCT
ACTACGAGAACGGCAACGTCTTACGAGATGTGAAAAAAGCACGGAAAAAATACCTCTCGTCCCCAGCATTTGCAGCTGACTTAATTGCTCTCGTGCCGTT
GTCCGTCTTGCTGCCGTCGAGTTCCACTGGATCTCGATCCATCTCGCTGTTGGAAATGCACAAACTCGTCCGCGTGTGGCGTCTCCCAGCTCTAACGTCC
AACCTCGACGACCTGTACGCGCGGCATTTCGCCTCGCTCAAGCTCACGAAAGTGCTCGGTTTTACGCTGCTCATGACCCATTTTGTGGCTTGCGGTCGTT
TTAGCTTCGGCTACGACCATCCTGGCCCCGGAGAGGAGCCGAATCACTGGCTGCCTCACGCCCCGCATGAAGGTCATCATACGGAAAGGAGGCAGTACCT
AATGTCGCTCTTCTGGGCCTTTGGACTACTGACAGGAGGCTTTGAAGGTGAGCTGCCCCACCATAATACCGAGTTCGCGTTTACGATCGTCGTTGGACTC
TGTGGCTTCACGCTTTTTACGTCGTTGTGTGCGACGTTTTTCCTGCTTTCCAAGTGCGAAAGCGGCGACGCGGAGCTGGCGGAGGCGCGTGTGCACCAGT
TTCAACACATTTTGGCATTTCACCGAGTTCCAGTTCAGCTTCAGGCCCAAGCTGTCGACTACCTCCAGCGGTATCACACACAAGCGGAGGCTAACGACCG
AGAAGCTGCACGTCGCTTGTGCCCTTCGATCTCAGTGGACATTCAAGTGGAGCTGCTAGAAGCTACTGTCGCTTTGGTGCCTGTCTTCGCTGGCTGTGAT
ACGCTCTTTATCCGAGCGGTGGCTCGACTCCTGGAGTTGATCGCACTGCCGGCACGTGTGGCTCTCTTTCGTGCGGGGGATCACGGCGACGCAATGTATA
TTGTCCACACGGGGGTTTTACACACTGTGGTGGGTGGTGTTAAAGTTCGGGAACTGAGGAAAGGAAGCTTTGTAGGCGAAGTCGCAGTTTTCGCTCGACA
GCCACGCACAGCTACAGTCATCACTGCTACGTATTGCACCTTGTATCAGCTCTCACGGGCTCATGCCGACAAACTGCTGGAGGGATATCCACAATACGCT
CAAGTGATCAACCGGACCGTCGCCGAAATGCTCCAACAAAGCACCATGATCCCACCGACGTCTGTGGAGACGATCTCTGATAGAAACGAGGTAGGGGACA
GCATCTCGGAGAATGCAACTCTATCATTCGCACAGCTCGTTCGACTTAAGCAGCGCCTGCATGCTCGTGCTCTTGCAAGAAAAGAAAACAACCGGAAAGT
GATGGACGATCCCTCAGCGCAAAATGATTCTGGAGTGCGTGTTGAAGTTTCTACTCCATCCCAGAAACCCAATTTGGAGGCAAAAGTCGCAATTCGACCT
CTTTCAGTCGAAGTGAAAGCGGCTGAAGCTGTAAAGTCCCCTCGACACTCGTTGCCAATGCCAACGCCAGTGCTACAAAACGCACAACGGGACAGTTTTC
GAAGCGATAATATTCTCTCATCACGGAAGCAATCGAAGCAGGCGTCACGTTCAACGTCGGTGAAAATTTTCCCAGTCGTTCCCCAAGCCACTGGACAAAG
ACGCAGTAGTCAACGAACGTCATTTATTGCGACAGGAATCAACCGATTAACCTTGTTACGGGACAACTTCTTCCACGACAACGCGGTAAAGCCGTCCGAC
GCTATCCAGGGATTCTACGATCAGTTTGCCCACCTTTCGACATCGACAACTTGTAGAAAACGCTGGTGGCATCGTCTGCTAATGAAAAATGGTCTCGATG
CCGAATCGAACTGGAGAATGCTGTGGATCGCGATGGTAACTACCGTGAATTGCTACAATTGGGTGGTTATTCCGCTGTTGCTTTCGTTTCCAGCTTTGGA
TGGGCTGTGGACGAGTTGGCATGTCATTTTGATGAACCTTTTGGCAGATTTTATCCTCTGGACGGATATTTACGTGAGTCTTCACTTGTCATTTTCAGTA
AATTCGGAGAAAATTGTGGAGCCGACACGGAGTGCTGAGCGTTATGTGGCAAGTGGGAGGATTTTCGTGGATCTCTTTTGCGCGTGGCCGTATTGGATAT
TTACACCAATGCAGTTCACGCATATGGCCTTACGTTTACCGAGACTGATCTGTGGTTGTTATCGAATGCATGGCTTAGTTCATGAGGTTGATGCGTATTT
TCGACTCAGTAGCAAACATAAACTGCTGCTGCTAGCCGTACTGTTCCTAATGCTGTACCACATTGTAGCGTGCCTTTACTTCAGTACAACATATCTCGAA
GGGTACAGCACGGGTGAAAACCAATGGCTTCCGTCCGAAGACGTGTATTTACAGCGTCTGAATGCCACATACTTCCAGACAATATCCGGGGATATTTTTC
CTTCCGACAGCACTCACGTCCAGGAGATTCGAGCTGAACAATACTTTCGCTCGTTGTATTACGCTGCAAACGTTTTGGCTGCGGTTGGTCGCATGATTGA
ACCGGCAAGTGACGCGGAGTACGGCGCAGCTTTGGTTTTCATGCTGAGTGGATTTTTCATTACGGCGATTGTCGTGGATCACGTTCAGAAAGGATTCACG
GCGTCCGCTTTAGAGCAGAAAGAGTTTTTCGCAGCTCGTTCTCGTTTCCAGCGCTTCCTCAAGCGACAGAACGCGCCACTGTCCATTCACTTGCGAGTCA
ATTCGTTCTTGGATTTTTGGTGGTCTGCCCATCGCGGTGCGATAATCGACGAGTTGCTGGAAGATCTTCCTGCTGCTATCAAACGCGATGTCGTACGTAG
CATTTGCACCCCAGCGATGGATTCACTGGAGATTCTATGTTCTGTCACTTCAAAAGTTGAAGCCATCACTAGGAGTAAAACATCTATAGAGGCGGAAACT
ACTGCACCAACCGTACAAGATCAAGTGGAGGATATTTTCCTGGATAATATCAAGTTCGTTCTCTACGGACAAGGAGAGATCATCTATCGCCGCGGAGATT
ATGCGGCAGGGATGTTTTTCTTACTGGAAGGTAAAGTTTCGGTCATGCTCGATGGAGAAGTGCCCCGACACGTCCCGCTCGGTGGATTTTTCGGCACAGC
AGCACTTCAGGTGTCAATAAGTCGAGACAAACGTGAAAGTAGACGACGGTCTGGTATTGGTTTGGCTCCTGGGATCGGGTATGAAGAGCGAGTCACTGCT
GTGAGTGGGTGCATAGTTGTGTACATCTCTCGCGAACATTTAAAAGCGATGCAGGGCGTTTTACCGACGCTTCCTGATCTTTTACGTAAGATGGAGCAGC
GTCTTCATGATTCACGAGTGACAAGATCCGCAGATTTAAGATCACTGAAACCACGAGTTGCCCTGGGAGCTGTTGGCTTGAATAATCCAACGATGAGACG
TGCACTGCGTCGCAAGCAATTGACAGGCCTCGTGCAGCTACTAGCGAAGAATCTGGAGTGGTGGCAACGTGGCACTGCAATTGACCCCGACTGGCCGTTT
GTGGGTGTGTGGGAAGCTTTGATGCTCATGGCTTCAACTGTGCAATGCACGTTAGTGATGTTTTATATTTGCTTTGGGGCAAGTGAATCACCAACAGACC
GTGGATTTTCCGATGCGGTGACTATCACTCTTGAACTATTTTTCGTCCTTGATGCTTATCTTCACTTGCGATTGGGCTTTTACGAGTACGGCAACAAGGT
GATGGATCTTGTGGTCATTCAGCGGCGTTATCTGCGTTCAGTACATTTTGCCATTGATATGGCAGCTCTAGTTCCGCTGTTTATTGTGAACTGGTCGCTT
CCTTCCAGGCATTTGGAAGTTCTGAATCTGAACAAATTGCTGAGATACTTCAAGGCTTCGAGCCAATTCCACACACTGGAGACCAAGTACGTGAAACTCA
TGACGGAGCTTCGACTGCTCAAACTCGTGTACTATTCGTTTCTGGCCTCGCATCTATTTGGCTGCGTCTGGTTTGATTTTGCAGCTCACAAGTCGGGGGT
TCACATCGTTCTCAGTGGATCTAGTGACACCTCTACACCATCTTTTGGAGCTTCGTTATGGGGGCCCTACGCTTCATTAGAGACGGCTGCACGAGGCCTC
CAGTACCTCGCATCCATTTTCTGGTCGTACGGCCTCATGTCCAACTCGAGCCAGGGGGAACTACCGAAAACCGTGGGGGAGTGTCTGTTCAGTGTCATCA
CGATGACTACGGGGTTCTTCCTCTTCGCCTACGTGGTTGGGCACATTTCCGATGTAATCGAGCTGCAGGACTCCGAAAACCGCCACTTTATCGCCAAACT
GAGCTCGTTACGGCAGCTTTTACGGCACTTTGACCTCCCTCCAAGCGTCGAAGAGAAATTCAAAAAGTATTTTTTCTTCAAACGCTTCCATTCGATTACA
CAGGAACACGTGCTAGAGCGTGTGCTGCCCCCCTCTCTCGTTGTGGATATGCGGATGTTCCAGCTGCAACCGATGATTGTGAAGGTGGCGTTCCTCGTCG
GGATGGAAGATTCCGTCACGCGGATGCTCGTGTCGCTTTTCACGCAAGTTTTGTTCGTCAAGGACGAATTCATTTGCCATTTCGGGGAGAAAGGCAGCGA
GATGTTCTTCATCTACACTGGAGTGCTCGATATCTACATCCCAATGCTAACCCCTACAAGTCCGGGTGAGTTGAATGTCTTCCCTAGTTCCGCTTCGGGT
GCACGCGTGAGTTTGAGCGGATTGCACAAAGTGAATGAGATCACGGCCGGAAGTTACTTCGGTGAAGCTGCTCTGTTCACAAACACACCGCGTAATGCCT
TCGTGAAGGCGAATACGTCTTGTATTCTATACAAACTCTCGCGTCACTCACTCGAGTTGGTTTTCGTGCGATACCCGGAGTGGCAGCAGAAGGTTCTCCG
TATTGTCAAGATCCAGCAGCAACAACAAAAACTCCAGCGTCTTGCCTATGAGGCCCAAGCTCCTGATGCTGGAGATGGAGGGCGTCGTCGTGGCCTCAGA
CGCGCAAGTTCACGTATGGATCTCGTCAATTCCAGGGCGGAGAATATCGAACAGGTACTTCTCAGTAAAAAAAGAGGCGCGAATACATCTAAAGACGCAT
CTCGACGAATAAAGTTGTGGATAATTCAGCAGTGGCGAAAAATCCAAGCAGCGAAGCTGGTTGTTCGTTGGATAATTCCATCGATACACTATCTGAAGAC
AATTGGGAAGCAACTAGCGTATGGAGCAGAGATTCAGAGCCCCTTTTACCTTCAGTGGATGCGATTGGTATCAACCTGTACAGTGTACGTGGCTGTGATG
GTACCATATCGTCTGACTTATGACTCCCTCGACCGCTGGAATATTATCCCAGTGAGTCTTCGGATATTTGAAGCTTTGTGTGAAGTGGTCTTCTGGGTTG
ACATTTGGTTTCAGTTCCATATGCACACGAACCAAGCGGCAATGGAGCTGTACGAGCAGGACCAGCTAGTAGGATACAAGCGCGAGCGACTTGCACTTGA
CCTTGCAGCCACGTTCCCACTGGACCACTTCGTTACGAGTTTCTCGAGTGGACCAAGTCGGTTGTTGCTCTGCAAATGGCTACGTTTGAACCGCTGCCTC
AAAGTGGCGAACCTCGTGTACTACCGGAACGAAATCACTCGACGTAGCGTTTCATACGAGGTGAATCGCGCGCAGACACTCTGGCTTTTGTACTTGCTGG
CAATGTTTTGGACATCTTGTGCGTATTTTGCCGTATCAATTTACGACGGATTTGGCACGGAGTGGCAGAACTGGTTACCGTCATCTGTTCTCGACTCGGA
CGATCCATCGCCCGAGCTTTTGATGCTTCGACTGTTTCGAGGATTGGCGTTTGCCGTCACTGCTTTTGTCAAAAAGAGCAGAACATTTGTGCCAGCGTCG
CAAATTAATTTCGCGTTTGCTCTTGTCATTTCGTTCATCGGCCAACTCGTCATGGCTCTTATGATTGCCGAAATGGCCAACGTCTTTCTGCTGTACATTG
ATAACGAGGTGCAATTCCGCAAGAACCACCTCATTGTCGAGCGCTCTCTCACCCGGTGGAAAGTCAGCGCGGCGTTAAAGCGACGAGCTGACAACTTCCT
CACCTCGTGGTGGTCTTCTCACGCGGGTGTTGACTATAAACTCATCTTTGAAGACCTTCCGGCTAGTGTACGTACTGAGGGAATAATGGCCATTGCGAAG
CAGCCTCTTGGTTTGTTTGTTTACCGAGTGTTCCGGCCGCTTATGCGAGATGGTTTCAAGGATACAGGCGCGGAACCAGGGGAAAACCCTGAAATTCCCG
ACTACGGCGCTAGCTTTCATCTGGATAATCTCACCTACTCGATTGCCAAGTGTCTGCGGTTCGAAGGATACCCACGAGGCGAGAATGTTATTGTGGAGGG
AAGCGTGTGCAAGGCCATGTACTTTGTAGTTCGTGGTTACCTTTTGTCGAAGAGTATGTCCAATTCGGACATGTATCCTGCCAGCCGCTATCGAGGTGGG
GACTATTTCGGCGAAATTGGTCTGCTAGGCCATTCAGTGAGTCTTATGACAGTGTCAAGTATCCGTGCCTGTGACCTGTTCGTATTGAATTCGGACCAGT
TACTTCAGGTACTACACGAGCACCCCTACTTCAGTCTAGTGCTGGCTACTGCACAACTTGCTGTACGTGAAAAGAAAACGACTGCTGAATTTTTGGCGGA
TTGGTTCGCCAGCAGTGGGTCAAATGATGAGGATAATACGGACGACAACAGCAATTCCGACGACAGTAGTGACGATAGCGATGACGAAGATGACGCTAGT
ACGAGTGAAGCTCTAAACGATGACGTGAAGCTGAGGCGCGGGAGTCAACAATTGAAGAAGGCACTGCACAGTGTGTCCAAGGAGAATATGGATGTGTGGG
AGGAAACGTTTGCACTGTTCATGGAAATGCTAGTTCCGAAGGGAAACATGGGCAATGCGGTGAACCCGATTCACTTCAGTAGAGCCTAGCACTACTACAA
GTACAACAACAATTTTGATCCGCTCATTTGAAATTGCTTTCTAGGTGATACGCTTATTCTTCTGGTGCTTTAATCGTCAAGCTCCATCATACCTTCGAGT
CGCATTAGGATCTTGGTCAAGTTGTTCATTTTTGCCTCCAGTCGTTGCTCTGTTTCTACAAGTCGCTCCTGGAACGTCTCTTGCATATCCAGCAGTCGAA
GAAGAAGCTCGTTATCAGGCATAATTAGGTGAGAACTACTGGATTCAGCAAGTCTTGGGCCGTTCAGACCCACTGCATCCGCACTAGGACCGTTCTGAGT
CGATGCACCGTCAACTGCACTTGGCTCGGTTGATGTCTGGTCAGAACCAACGCTAACAGACGTAGCTAGTGCCCGTGGCGCTATTACTCCAATAGACTGG
CGATGCCCAAAACTGTCAGTACGAGAAGAAGCTTTGCTTTGGAGAAGCAATTCAGTCGACGATGGGAGAGCGGTGATAGCACCTGATCGATGTCTTCCAT
TAATGGAGTTACGACGATGTTGGTGGAAACCAACGCCAGGAACAACCAATTGGTTCATGAACGCACGATTCTGTAGGACTTCCAGGTCATTCCGGAATTT
CGCCAGTTCGTCATCCTCGAGCATCCCGCTGTTGTCGGTATCGTAAACGTTAATCACGTCGTCGATATCGAGATGAATCCCTTCCGTAACGGCGTGGAAG
CGCTCCAATATGGCTTCGATTTCGTTGCGGCAGATCATCCGCTTGCCTTTGAGGTAGTCCACGTTGCTCTTCATTGTTTCATGCATGACGGACTTCATCA
CCTTCTGGAAGTTGGTGCCGATGACTGTGATGGGCAACGCGAGCACGAGCATTCCAGTGAGGACGGTGCAACAGCCCACGACCTTACCGAGCCACGTTAC
CGGTGTCATATCTCCGTAGCCCACAGTGGACATGGTCACGATGCACCACCAGAACGACGTGGCAATACCTTGATACGGGTTCGGATCCACGCACACACAG
GAGTCACTTGTTGATACAGACGCCACTGCTGCAGCTGCAGATACGGAATACGCGACTTCTGTGGTGATGACGTCGCCTGAGGAATCGACATCGCACTTGC
CCATCCATCCGTCAGCTCGGCAGCCATCGGGCGTGAACTCGGCAAAATAAATAGCCGAAGAGAAGATAATCATGGCAATGGACATGAGGAAGATCAGCAT
GGTGAGCGGCTTGATACTGATGGAGATAGCCTGCGTGAAGACTTGAATTGCTGACGAGTACCGTGACATTTTCAAAACTCGTGCTACTCGGGTGAGACGC
ACAATTCGAATTGCGCCGAAGGATCCAGCGTTGTCCACAGCTAAAAGTGACTCCATGTAAAACGGAAAGACTGCCGCGAAGTCTACCCAATTAGAGTAGT
CTGCACAGCAAAGTGTTTAGATCAAACACAAGTACAAAAAGATAGAAAATCACTGTACGTACCTCGGAGAAAAGCGAATTTACTTGGGCAGACAAGGAAT
CGACCAACAAGTTCGAACGAGAAGACTCCTGCACAAAGTGCCTCCATAGTTGTAAGCACCACCATATACGGATCGAAAACTGCCTCCGTTTCAGCTACGA
AGACGAATGTAGACACGATAATAAATCCATATATCCCCAGGGAAAAATAGTATGCCGGTGTGGACGACTGCGGGTCCTCAAAAAATAACCAGAGTTTGTG
CATACAGCCCGCAGGTTCGCTGATGCTTTCTGCTTGCGAATCCGAGAACATCTTGGAACCTTGTCGTGTTTGCGTTCTTTTTGCCGAATCGGGTGTTGGC
GTTTGGGAATTGCTTCTTTCCACTGTCGTCACGACTGTGTCTTCCTCTGGCATTGGGGTCACAGACAATGACCGTCGACTCCGAATGCTTCTTTGGCTTC
TTTGACTTCGTTGGCTTCTCTGACTTCGGTCGAACGCCTTTGGCCGCGAGAAGGACGGGAAATGGTTTGGAACATGAAAGAGTCTGGTGGTGTGCAGTGC
TGATCGACGTTTAGCTTCACGCTCAATCACTTTCGAGAGCTTGAGCGCTGTCTCAGTGAGCTCCGTTGGGCCTGAAGAGTCTCGCATGACGATTTACTTA
TCGAGTTCCGACCGGATGACACTTGACACCAGACAACGATCGATGGTGCAGTTCAAATGAGCGAGGACGCTAGCAGCGTACCCTTGCAAAGCGAAGGCCG
ACCTCTAAACATTGTACAGCAGTTATTCATCCCCTAAAAATATGTCGAAGGTTTTGAACATCCAAGCAGTGCAACCGTTATGTTGACGCACATCAAGAAT
CCCACCTGAAGCCGAACTGGCAACAGCCCCTGGTCTATTCATGAAGGTACAGTATGTTCTGCGAAGGCTTTCAGCTGGATGTCACCACTGCTTTCTCATC
TTTGGGCTCTGTACTACCGGCAGGTGCCGCAACTGCTGCACGCGCAGCCTTCGCCAACTCTCGTCTGCCAGCACGATTCGTGCGCAATGCCTCCTCTTCC
TTTTCCCTTTTCCACTCCAAATAGGGCTTCGCAACGTAGTCGAAGGGCAACACCTCCAATGTACGCAGCCATTTCGCGTATGTCCGGGTACGTTCTTCGT
GCTTCATGATGTGGTCAAAGATGAAGTCACGCTTGAACTGCTCCACTGCGGCGGCAACGGCAGGATCCTTCAGATCAAGAGGCGGGTGAGAAGTCTGGAT
CGAGTCCTCCATCTTCATGTTGTACACTTCGAAGTGGGCCTGTGCCAGGTACAGACCGACGCTAGGGGCCTTGGGCAGATCCATCTTGGTCAGTTCCATG
GCACGTTCAATGGTGGAGGCGTCAGTAACACCCGACACGATTTCTACAGCAGCGCCGATCATCTTGCGGATGTGGTGCAGCAAGAAACTCTGTCCAACTA
CACGCAGACGCACCCACTCCATGTCATGCTGCACGAACGGGCGGTCGGCCTCGAACGAGATGATGAAGCGATTGGCCTGAGGGTTCGTGGGCTCCATCTT
GGACGTGAAGTTGTGGAAGTTGTGTGTGCCCACGTATAGTTTCAACGCGTTGTTGAGCTGCTCCAACGTCTCGTCACTCAGTCGGAAGGCCTTGTGCGCT
TCCAGTGTCGTGGTATCAATCACCACGGTGTCGTCGAAGCCTTCTTCCGAGTCACGCAGGTCGGATGGCCACTGGGAGGCAGTTTCTCCCTTCTTTTCCT
CATCCTTCGAGGCCACAGAGCGTGAACGCTTGCCGAAGATGAAAGTGGGCGCTAGGTACTCGTAGGTACGTTGATCGCACGTCATTTTCGCATTGAAAGT
CTTCGTAACTGTGACCATGTGCATCACACGAATATCCTCGGGCAGCGCCGCGTTCACCTTGGCCACAAAAGCTGGGATGTCGTCGCCCACGTGCAGCTTG
GCCGTGAGCAACTGGCCAGCAGCATGCACGCCCTTGTCCGTGCGGGCGGCGCGGCTCCAGCCGATCTTTTGCAGGAATCCGTAGTTGCTCTCAGCGATTC
CGCCGGCCTCGAACAACGCACGCTCCAGCTCCGCCTCGATGGTCTTGACGCCTTCGTTCATCTGCATGCCGCTGTAATTCTTGCCGCAGAAGGCCACCCA
CAAGCCGTAGCGGCGCTTAGTCGGCAGGGACGCAGCTCCAGCATCTGCCGGCGTCTCGGATTTCACCCGTTTGGCTGCGTACGACCCCGGGTGGATGGCA
TCGGAGCGGTCAGCGCGATGGTCAGGACGAGACTGCGTGTCCTCCTGCTGCTCGTCGCCTCCTTCACGTCGCGCCTGCTTGTTCTTGCGGCGCACGGCCC
AGTGCGTCTTCTTGCGCTTGCCTGCCATTGGAATAATGGCTGGATGGTTGATGATAGGGTTAGAGACGAACCCTAGATGTAGTGTGCACCACACCCGTCA
CAATTCTGAGGGTCGAAGTGGTCGGACGTGAGCTGCTCAGTAGCCGATTATCCATTGTGAAGGTATCAGTCGGGATGGTGTCGCTGCGGAGCCTCCAGAC
GATGCGGCGTGCGGCGCAGGTGGCTGTCAAGTCCTCCAGCACGCGCCTGGCGCCTCTGCAGTCGCTTGGTCTTCAAACTCGCGCCTTCTCGCAGGCGCAC
ACGCCGTCGCAGGCCGTGGACCCCAAGGACATTCTCCGGCCTGAAGTGGCCAAGAACGCCAAGGCGCAGTTGTCGCTTGAGCAGGAGTTGCCTGATCTGC
CCAAGCTCAAGCCCGCGAGCCAGCTCAAACCCCCGCAGACGGAGATCTCGGTTCTGCCCTCGGGCTTGCGCGTCATTTCGCAAGAGACTTACGGACAAGC
AGCCACGCTCGGCATCTTCATCGACGCCGGCAGCCGCTTCGAGGACGACGAAAGCGTCGGCGTGAGCCATTTGTTGGAGCATCTCGGCTTTAAGAGCACC
ACGTCGCGCTCGCATGCGCAGCTGGTGCATGAGATTGAGGACATTGGCGCACTCACGACGTCCTCGTGCGGCCGCGAGCAGATCATTTATACGATCGATC
TGCTGCGCGACAATGTGGAGAAAGGGCTGGAGCTGCTGGCTGACGCCATTCTGAACGTGGACCTGGTGCCTGAGGAGATGGAGGGGATCAAGGCTATTAT
GCGCATCCAGACGGAGGATCTGATGGAGAACCCGCCCGCCATGCTGCAGGAGTTCATCCACGCTGCTGCTTATGGCGCTGATACCCCGCTCGGACGGCCG
TTGCAGTGCCCGCTGGACAAGATCGACGCACTGACTGTGGAGAAGGTCAAGAAGTTCCGTGCAGAGCACTTCGTCGCTCAGAAAATGGTCCTCGCTGGAT
CAGGTGTGGACCATGCACGTCTGGTCAAGTACGCGGAAAAGTTCTTTGCCAATGTGGCTGTGGCTCCGAAAGATACACCAATGGCAACTCCTTCGAGCCC
CGAGACGCTGGAGCCGGTGATCTACACAGGAGGGTTGTACCCGCTCCCGAACCCGGAATCGGAGTTCTCGTACGCGGCTCTGGCATTCCCCACGGGTGGC
TGGCACGACGAAGACCTGGTGCCCATTTGTGTGCTGCACACGCTGCTTGGTGGAGGCGACAGTTTCTCTGCTGGTGGTCCTGGCAAGGGAATGTACTCGC
GGTTGTACACGAGCGTTCTGAACCGCTTCTACTGGGTTGAGTCAGCATTCGCATTCTCATCCATTCACGCAGACGTGGGCCTCCTGGGTATTTACGGTGC
TTGTCTCCCTTCGCACACCAGCAATCTTGTGGCACTGTTGTGCAACCAGATGCTCAGCGTCGCCAACCGACCGGTTGATGCTATTGAACTTGCTCGTGCG
AAGAACCAGCTCAAATCGTCTGTGCTCATGAACCTCGAGTCCCGCATGATTCTGTACGAAGACATTGGTCGCCAACTTCTCACTTATGGCGAGCGAGAAA
CGCCTGAATCTGTGTGCGCCAAGATCGACCAGGTTACGGCCGCAGACATCCAGCGAGTTGTGAAGGAGGCAATGCAGAACCCGCCCAGCCTCGTGTACTC
AGGTGATATCCCGCAATTCCCGCAGTACCAGCAGGTTGTTGCCGGTATCAAGGAAGGACTGAACGAGTAAGTGTATTCCAAGCAGCACATTCAGCAAGTC
AGGTTGCGAGGTCTCTCACCGTCGATGCTCACAACCTTCGTGTAGAAAGGGATAAGCAATAGAAAAAAGGTAAAACAATCTGTGGGTTCTAATGTACTTC
ACGGGCAAAAGGAATCCCAGAAAGCACCAAGATGCTTTATTGATTAAACCTAACATGTAGAAGCGAGAAACCAAAGCAATATCTAGTGACGCTTAAGTGC
AGCTTCTTCTTGCAGCAAACGAAATCCTCGAAGGTATTGTTGACACTGTGCGGTGGTGTCTGTCTGTAGGTCCAAAGTACGGCAAGGGTGCACGAACACC
AGCGAGAAGCAGCGGGCAGGGACATCAGGTCGTTGACGAGCAAAAGCCTCAGTCGTAGCACCAGGCAGCACCTCCACCAAGTCGCACGTATCGACTTTTG
CGTCAGCTTTCGGCTGCATCAGCGAGCCGTGCGTCACCGACGCCGCTGGGGCGCGCCACGATAGCCAGTGACACTGGGCATCTGCATACACAACACGCTG
GTGAGGAACGCCACGAGCCCCAAACTTGGTTACAACAATGCCGTTCTCAAGTTGCTTCTTGAATTGCGCAAGAAATTCCTGCTCCATCGCCTTGGCTGCT
ACTCGCGCCCGACTGGCGGTCTCCAATTCATTAACCGCATATTGAAGCCGATTCTTCTCAGTACGTTCGTCCTCACAACGCTGCTCAAGTTCGCGGATCT
GGCGCTTCAGGTCGTTTTGAACGGTTTGTGCTTCCAGCTCCGCTTTTTTCCGGGCAACTTCGAGCTCGGTACTAAGCTCACTTCGCATGCTGCGCTCACG
GTGCTGGGCTTCTCGTAGTTCCTCATGTAGCGATGCTAAGAGCTGCTTACTCGTAGTGTTCACCAGCTCCAATGCACTGACTTGTTCCTGCAACTGCTTT
AATTGCTGGTCATGGCACGATAATTCTACCAGCAGCTCATCTCGGTACTGATTCAGGTCGGTGTTAGCATCTTGCAGTCTCTCTTGTAGTGACCGAGTAG
GTGGCGCTGATGAATCCGTGCCAGCTTGAGGCATCAATACTGCAGTCGATGTACTTGGCTGTAAATCCACTGAAGGCTCTACGATGGGTAGGCTTTCTTC
TGCTGGTTGGGCCATGGCGACACGTGAGTTGGCGACCTCAAGCGTGGCCTTCAGATCTTTCACCTGCTGGGCTTTAGCTGCATGGGCAGCCCGAAGTGCA
GCAAGGACAACCTCAACTGCTCGATGAGCCCTCTGCGCGTCGACGAGCCGATCATGGAGTTCATCTACTTGAGTCTGTGTATCTCGGTGTTCCTCTTGCA
GTTCTTGCCACTGAAGGGCTAACATTTCCTTCTCATGTCGAAGCTGATTCACTTGCTCGCGGCTTTCTTCAGCAGCAGCGGTCTGTTTGGCGAGCTGCGC
CTGGAGATCTATCAGCGATTGCTCAAGCTCCTCTTGGTGACGCTGCAATTGTACCTGCTCATTTTTTACCGCTCCCAGTTCGGCTTGTGTAGTCACTGAC
GCCCGCTTGTGCCTCAAAAGTAGTTTGTTGACTGCAACCATATCATCGCGTTCGCGCTGCACTTTGCGAGTCTCCTGCAACAATGCTTCTAGCTGACGAG
CAGCTACGTCCTGCTCCTTTTTTATAGCGTCTTCTCGTTCGCGCTGCAACGCACATAGCTGCTCTCTCACAGAGCTTAGCTGCTGGCTCACTTCAAGATA
CTCGGTCTTCAAGTTATTCACCAATACATCCGAACCATCGGCATCTTGTCCTGTTGTCTCGGGAAGCTGTAGGCAGTCAGTTTTTACTTCGAGGCCAGAT
TGACTATTGCGACGTGAACTCGGCTTTCCCGGGCCCATTGATAGGCTGCTCCTACGTCGTGTCTGCCGCATTGGAGCAATACATCCAACACTCCTAGATC
GCTCCACAAGACCCGAGTTCACCTGACCCGAACTAACATCAGCCAGAGTCAAAGTAAGCGCTGGCTTCGCATCACGCATCCTAATTGCAAGGAAACAATT
GAAAAGGTTATTGGACTGTTCATCGTAAGAAATAAAACGACGAAAACTCACATTTGAAGAACGTCAGCGTACGATATGTTGGCAACATCGGTTCCATTTA
CCACCCGCACACGTAGATTGGCAACAATTACGCGCGAGTAATCCCCCGCTGCACGACAACGCGCATTGTAATCTGCTGCGAGCCCCACAGGTGCTATATC
CCGGACTATGCAAGCGTAACTCTCGGAGGGAACGAGGCTAAACTTGTTGGACTTCGACGCCGGTTGAAATCCAAGACCCACCGGTTTGCTGTCATCGAAA
AATACGCTGAATTCCTTCTCCCACTGACAGGGTTCTTCATTTTGTTTAGCTCGAAAAGCGGCCACCAACAGTTCGTTCCACGCTCGCTCTGCTCCAAATC
GCAGACCTTCCGCTGCAGCCTGACTCTCCTCTGACTCGTGGCTGCCAGAACGCACCCCAGCAGCTTCTTCACTCCACGGTGGGCTGCAGAATTTAAGCAC
CATATCAATAGTTCTGCGGCTACGTCTTCGCTGCTGATGCTGCCACCCTTACTTGGGCAGTTAGAAACGGATTGTGAGCGCTCAGCTCGAAAAGACTACC
AGATTAGACTGCGTACTCAAGCTAAAATAGGCTCACTTGAGCTCATGCTGCAAACAACACCAACGACCGCAAGCAATAACATATTTAAGTTAGTGAATGC
TGCATCTAGGACAAAAAATAAGAAATATCAACCGCCTCATGCCTTCGTGTGTGTCTTCGTTGCTTCATTCACAGTTTGTCCACTTGATACCGCACACCTA
TTGCAATAGAGAGCAGCCAGGGATGCGGCACGCCGGAGTGGCTGAGCATGTTGATGCATGTGCCCGAACAATTTCCCTCCAGAGCTTACATGCTCCGCAT
CTGTTAGCATCATGAGTCGCTTTCCCTGCCATGGTCGTGCGATGGGTGTTCACCTTCTCCACAAACGTGCGTGTCGAGACACATAGCGGGTTGGAGCAAC
CGTTGGCGTTGCATGTCGATATATGCTGCAGCCCCCGAAGCATTGATTGCATCTGAGCAGCCCCTGGTGTCGACGCCACTGTCTTTGCGGGAGGCATCTT
TTTGGCATCAGAGACTTCACCAACTGAAGTGGGGCTCAGCGGGTCGTGACGCAGGCGCTTCGCCGATGGCGGACCTTGCACTTGGCATCTGACAGACGGA
AGAGCTTCTGCTACATTCCTAGCAGCCCCTGACGTCAAGACGGTGGTGGAAGTTCCACCTATATAAGTCGATGGCGACGCGAACGCTACCCGTCGCGGTG
TAAATGCAACACGCGGTGGCGATTCTCCGACGGACGCAGACGAGTGCGAGTCGCCGCTGTGGCTGCGTTTGCGAGAGAGTCTGTTGGCGACGATCTGCGA
CCGCGAGATGGAGTAGGACGGCGGCGGCGGTCGCGACAAGGTTGAAAACGGGAGGGCAGTGAGGGCAGCTACTGAGCCAAAGTCGTCTCGATCAGTCCCG
CCGTTCGTAGGAAGGCTCTGCGAATGGGAAGAGAGAAAAGAGTTAAAAACTGTTCTTCTTGAAGTTAGCGACTATCAATACGCACCATTTTAGCTCCATC
GGCCACGAGGAGAAGGCCCGCCAGCTTCACGACGCGGTGGATCACTCACGGAAGGAAAAGGGAAGAAGAGAACCGGGCAACGAGAGCGTGCGCGGTGCTT
CGGCTATTGGACTGCTCCACGTTCTGAGACTTGTGCAAGTGGCACCATCACTCTCATTCTCAGGGCTAGGGGCTGGTTGTTCCTCGCACAGTCCTTGTGG
CGCTG