Description :
From Genome Similarity Track
Location :
Scaffold_21:300745- 305436
Sequence
4691 bases(100 bases per row)
TTTGCGTGTAACGACTTCAAAGTAAGTTCAAAGTACCCGGGACGGTTGTGAAATTCGTCAAAATTGGAAAACGCAGACCAAAACGGGTGTCAAGGTACTG
CGTAGCAAAAACGGTGAAGAATACGTGCCACTATTTTTTCTGCACGTTACTGTATTCGAGGCATTGTTAGCATTGCACGTATCCGTACACGCTCCAGGTC
CCTGGAGCGACCAAGCGAAAAGACCGGACTTTAGTTAAGAGTGTGCAATGTATAGTAGAGAATACACAACTGCAGAAGCTCTACTGGATTACTGCAGTGA
TGACAGCATCATCTCTAAGCAATATGTGCCAAATTTGTGCGTTAAAAGCTAATACATCTCCGCACAAGGTACGCACTAAAATTCTGGTACTGATGGAGTT
AAAGGTCTTTTGATTCGATGCGTAAGTGCAAGTGCCGCACGAAAAAAGGTAAAAACTCGACCCTAGGTCATAGCTGTGTCGCTTCCAGATCTATTCGAAT
CATAAGAAGTTATCGGTGCTCGAATGTTGTGGTGTTAATACACTGTCATTAGAGACATATTTGACAGAGGCACACTTAACTATGCCGATGCCACAGCAAT
TGGATTATCAGACTATCATGAATATATTGATGCAGAAAAGCATCGTAATCATGGAGAACAGGGAGACAAAAGAAAACAAAAGAATTGGATGACAGGTCAT
CGGAATCAAGTTGGTGATCGGAGGACGCAATGAAAGTAAATCAAGTACCTCCACAAGAGATTAGCGGAAACGTCAACAAAATGTCGTGTGTTCACTAGGA
TATAAGCTCCATTTGCGTACGTTCTTGCTACAGTGACTGGCGGCATTTCCTGCAGAGGAGCGGTATAGAAGTATGTTTTATCCTGTTGAGCAGACTTAAC
GTGTGCACGTTGAACGAGATGATCACTTGCAGGCATGTCAGCATTGCTAAATGCGATAGAAGAAGTAGAAAGACAAATTTTGCTTCGTGGATTCTGTGGG
AGATGTTTTTATGACCAGAATACTTCCAGGATATATTTGTACCAGTGTACAATTTCGCGTCGATACTCGTCATCTTTGATTATCTCAGATCAGTAAAAGC
TTGTCCAGCACGGCAACAGGAGAAGATGGCATTCCCAAAGAAACCCTGGACGAAGGAATCTACTATAAGTTGCCAATCAATGTCATCGGCTCACGTTTTC
AGATCACGTATGCATTCTAAAGCGTACATTTAATGGCATCAAGTAGTAGCCATGGATGAAGAACTAATCTATTGATGAGTTTATACGCATTATAGGCTAT
ACTAAGTGCAAGATGGACCACGGGTCACATGGAAAGAGAAAAATATCGACATGGTGTTCTTGGTTATCTATTTTGATGATTCTATTCCGGCATGAAAAGA
ATTAATCTGCTTGCCCCACCAATAGTGAGCTAAGTAAGCGCTTCCAAATGTTGACATTAGTAAGCTTAATTTATGCCTCGTACTGGTATTCCCTCTGGCG
CCTTGAGTAAGCATTGCCGATCCAATCACTTGATTGTCGATTCGATCCCCTATACGACCATCCCAAGGTCGTTAAAAAAGTGTGACACATAAGGCTCAGT
GGCACCACCCGGAAACCCTGGTACCTCTGAGATCGGCCACTCGTAAAAGCATAAACCCCAACATCGAATATCGGGGGCCCTGGACTGTCTGGCCTCCATA
GATTCTAGTAAAATAGTGGCCATACGGTAGGGGATGTGTAGGCACCGGCCGAAAGGGTATTCTCGGGTCGTTAGTTCCTCTAAATGACTGTAATGTACCA
CAAAAAAAGTTCTGCCTCGGTATGGAAGTTGAGCGATGACATATCGGGTTAAGTTTCGATACGGCAGACCAAGTTATTGTAATAGCTTTTAACAAGGATT
GGCACTCAAGACTGCAAACCTGTCAAGCCACCACAAGCTCCTGGCCTTGGGATTCTAAAGAAATGTTTTAAGAAGGGTGCAATCACGCCGAATCGATGCA
GGGTGTGCCATACCGCAGCGTTGTTGGTGCATTGATGTGCATGATGGTTGGAACCCTCCCAGGCCTTGCTGCAGCAATCGTTATCCTCAGTCAATTTGCC
GTGGATCCATGTCCACCACAGTGGCGATGTCTCAAGCAAGTGCTTTAGTATCTACAAGCGACTGCGAAGAACGGCACTAGAATTTACGGCGCTAGTGATG
GTGATCTGGTAAAGTTATAGGCGAAAATGATGTCTTAGGAAAAGTCTGCCATTTAGAAGAAAATATATCGCACTCGCTCATTGCAACACGCGTTATAAAT
TCACGAGCATCAATACGTTTCGGCTCTTACACCGTATCTCAGGGCAACTGTATGCTGCTGTGCACATACGCTTGGCAGATACGGAATAGGCCTCAGAAGA
TGGCATATGAAGGATGCAGATTATGGGCTACCAACTATTGCAAGTACCGTAGATTCTTTGATGTGTCCTATTCGTCATTAGGTGAGTCTAGAGCGGCCAT
TGACTGATGAAACGACCACATCCGTGAAAATTGTAGTGAATCGAATCTATTTGTCGTATACGTCAACTGCGTTATACAATGTGATGTACTGAACCATGGA
CACATATTATGTAGAGCTATACTAAAATTTGACAACAACCCCTCTTTTGCCTAGTATGACTCTAAAATCCGACGTTTAAACTTAGGAAAAATATAACGGG
ACTCCATTTCGACCAGTAGTGGAGCTTCATCTGAGCAATAGTAACGCTAGCCACGATGTGATGACGAAAGATTTTAATGTAGTTCATGCTAGCTTATTGC
ATAGAGCTTTCCCAGTACTAGTACCGCCGCCAGCGCGATTTCTCAGTACTAGTACCTGTCCCACATCTAGTACTTGTACCTCCTGATTGTGCGGATCTGA
ACTAAATTACATCATATACTCAACATAGCTGTAGTTACGCACCCCCCTCATCAATATGCGCCAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN