Description :
From Genome Similarity Track
Location :
Scaffold_70:30074- 33506
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_70-fgenesh-gene-0.16Tetratricopeptide repeat protein 37 (TPR repeat protein 37)

Sequence
3432 bases(100 bases per row)
TGCTCAAAACCAGAGAAGTAGACCCCGTGCGCATTGCACAGCGCTTGCGCTTCGTACCAGCAGCTCAAGCCGATGTCGTAGAACACTTCAGCGAGTCGCG
TAGACGGGAACGCGTCCTTCAAAGCCAGAGACTGAGCGGTCGCAGCAACGGCTTCGTAGGCTTTTCTTCCTTTCGCGATGAACTCAACCCAACCAGTCAA
GCCATTCTCAAAGTCATTTGGCGCCAGGTAGAATGCAAAGCAGTGGAGGTCCCCAATCAGCTTGAGCCCTTCCACAGAGCTGGAAAGCTCCATGGACGAT
GACGAGAGCGACGTCATGAGCCCTGACGCTTTCTTCAGATTCACAGACGCGCGGCCGTACAACCCCTCCGCACACAGATACTTGGCTTGCTTGAACAGGA
GCTCCGCGTACAGCATCGATACCACGGATGCCTGCTGCTGGTCAGATAATGACGATGATCCGTTACCACCAACAAACGGCTCAATGTGCTCAAACGCTTC
GTCAAAGAGCAGCAACGCGCCTTCGATGCGAGCCAACTCACACATGACGCACCAGCCTGTCTCGCCCAGCTCCACGGCTTTCAAGTATGACTTTTGCGCC
GACACGAGCTTCCCGAAATGGCGGTATACGTGGCCCAGTGTAACCCAGTAGCGCGCATTGAACGGGTCGTTCCGCAGCACCAAATGGAGCTTGCCCACCG
CCTGCTCGTCGTCATTCTCGACCAAGTGCTGTGCAAGGCGAAGCAATGCCCACGTCGGCGCAGACACCGGCTCCTGCGTCATGTCTTCCCAGAGCTTCAC
ATTCAACGCGTGTTTCTGCTGCTGCTCGTAGAGATCGCTGAGCGCCACGCCTGCGATTTCGTTGTTAGAGGAGAGCGAAAGCGCCTTCAGGAAGCACTTC
TCGGCGCGAAGGATGTCCTGTGCGATCTCCTGATACCACTTGCCGAGCCAACCAAAAATCTCGCTGTCGGACGGCATCAGCTTCGCAGCCTGCAGCAAGA
TCCCGAAGCAGAACGCTTTCTCGCGACGGAACGCGCCGTCCAGGTCCCAGTACACGATCGCCAGTCGCTTGAGCGCGCACGCTTTCTCGATTTGAACAGT
GATCTTCGGAATTGCGCTTTCAAGAAGCGCTCTTCCTTCGTCGACTGCACCGAGTTTGAAGAGAACCCATCCACGGACACTGGAGATGACCGCTTCGTCG
TTGTCGTTCAGTGAACCACCAGCAACCTGAGAAGCGAGCGCATCCAGCGCGTCACGTGTCTCGGCAAACTTGTTTCTCGAGAGCAAGAGCTCGGAAAGAC
GAACTGTTGCCTGGAACGCCGTCAGTGCATCGTTGTCGTCATTGCTGACCAGAGCCTGGTATGCCGCGAACGCTTGGTCATAGTCGCCAGAGTATTCGCG
CGCAGTGGCTTCCATCAGCTGGGCTTTCGCTTCTGAGTAGCTGGAAAGTGGCGACGTTTATCAACATCGAGTCAGCTAGTCAGCATAATTTCCAAATGCA
ATATCCAGCGCACCAGCAATATGGAGAGACAGAATACGTACATGAGTGGGTTGGGCGGCGCACAGCCAAAAACCTGCGCTTTCTCAATGAGCAAGCTTTT
CGCTTTCATCAGGCGACTGAGACAGCCTTCGACGTCGCGAGTGGACAGCGCGAGTGCTGCGAGCTCTACCTGCGCGCGAATACACAGCGCGCTCTCGTAG
AAAGACGACGACGCGCAATAGGCGAGCGCATCGAAAATGCTCTCGCGTGCCTACGAACAAATACAGTTCATCGTAAAGTCGCCTTGTGAGTACAAACTCA
AACAATGGTTTTACTTCTTACTATCATGTAGCTCAGCACACAGTACCTGCTCGGTTTCGTTCGCTTCAAGGTGTTGCAGCCCTTTGAAAAGCTGGATCAT
TGGGCTCTTTGGGTGCACGCTCTCCAGCTCAGCGGCGAGTTGCGAGGCTCTCTCCATACCAATCGCTGTGTTAGCACAAAAGGAACACCCAGTCAGCAAT
CCAACATATACAAGTCCACTCTAAAATCAAACCATCACACGCACGACTGTCTTGGTCCTCGGAGCGCAGCAGCAGATACTCCGCTGGGATCTTCGCACTC
GGTAACCACGAGATAACAGCAGCCGCCTGCTCATCCAGTTTGCGCAGCGCCTCCTGTTTCTTCTTGGCGCCCGTCGCCTTCATGGCCTTGAGTTCATCCA
GCGACACACGCATGAAGAACGCGATGGCACTGTCCAGTTTGGACGTGACCGAGTCTTTCGTAGCATCTTTCTTTGCTTGGTTGTCGCTCGCCCAGTTGGA
GGCCGCGTGGAAGAATTGCCCCGCGAGCTCACTCTGCGAGACACTGGTCGCGCAGTCGGACAAACTGAAGTTTGGCCGCTAGGATCGAGTTTAACGAACC
AGGCGATAAACAGGCAAAAGTTAGTCACCATGGTAATAAGTAGCGGAGCATGTAAGCGTGTTGTACCTGAAGCACATCGACGAGGTCGAGCCAAAGCGCA
ATTTTCGAAGGCAGCTCGTCGTTTGGGGTCACGTCGAGACAGACCTCGCGCATCTCGTCACTTTGCGCGACCAGGAGCGAATACCACGCGTCGAAGGCCT
ATTTGAACACCATACACAGCGTCAGCCTACTCCGGATTCTTACGTATCCATGGTGACAACAGCTCATTTGCGGTTCTTACCTTTGGGTACATTCGCAGCT
CGAGCGCGGTCGCCGCGACGTCTGCGATCCACTTTTGACACGCTTTCACTTTCTTGTTCCTTTACAAACACAAGCAAACAAACAAACAAAAGCTGGTCAG
TTCGACTCATGATCCAGTGCGAGTGCTGCTCATGTGGATCTGGAAATTTTGTGAGCGTATGCGCACTTTTGGAGAATGGTGACGAGCTTCTCCAGCGGCT
CGAGCTTCTTCTGCGGCTGCTTGCGCTCCTCAAAGAGGTCCACGAGGTTCTACACAATGTATCGGCGTATAAAAGCGAGCAAACGAATTATACAACACAC
ACATGGCATTAGCCACATGCGCTCCTTGCACACACCAGATCACGAGCAGCTCTCGTTTCCTCTCACCTTCCAAGCGAGTGGTAAATCGGGCTTGAGTCCC
GCAGCGCGGCGATACGCTTCTTCGCAGTCATCCCACTAAATACACACGCACACACAAGGAGATCGTTCAGAAAAGTAAGCGCCGCGGTAGCAAGCCCACA
GCCGACTGAGCGATATTGCAGATGCATATGGACGACAGTTGAACGAGTGAACGAACGCACCTGCTGGAGGTGGAAGTTAGCGAGCCCGACGCATATGAAG
GCCTGGAAGTTGTTGGGGTCGAACTGTGTGACGCGGCGGCTGGCGTCCAGCGCCTGCTGGTACTTCTGCTCCTTGAGGTGTGCGCCGGCGTCCTCCAGCA
TCTGGCGCAGCATGCTCGCCGACATGTTCGCT