Description :
From Genome Similarity Track
Location :
Scaffold_198:30073- 31646
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_198-fgenesh-gene-0.8Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_198-snap-gene-0.28WD repeat protein 6.

Sequence
1573 bases(100 bases per row)
CATAAGGGAGCGTAGCCAACCACGTGCAAGCAGGGTGCATTTTTTCAACTTCAAAGAGATCTACAAGACCACTTCTGAAGCATTACTTACAGTGCCGCCT
GCTTCCAACTAGTCTCTCGCTTGATCGAGATGGAGAGCGCGATCGAAGACAGCTCGTACTCAAAGATCGCGTGTGGACCGGAGAGCATTGCGCCGAAGGT
GCTGGTCGGCATCATCGACGTCGCGGATGTCAACTGGAAAACGTTCTACGTCATCCGCTGCGAGATGATCAAGTCCACGTTTGAATGGACAGTGCAGCGT
CGATATTCCGAGTTTCTCAAGCTCAAGGACGACCTCGTGGCGTTCTTTGACCGCTGCATGGTGCCGCAGTGCTTTGGGTGCCGGTGGTTTTCCCAATCGC
TGAGTGGGTTTGAGTTCCCGCGGCGGCATTTGCTGAGTTCACGCGAGCCCGAGGTGATCCAGCATCGCAAGACTGGACTCGACCAGTTTGCTCGGCTGCT
CGCGGCGCACACATTCTCGACGATCCCAAAGTGCATCTCGTGCAGCAAGTGGCCGTTTGTGCGCGTGCGCGACTTTTTTCTCGAGGATGCAACGATCCCG
CCAAACCTGAGCTTCAAGATCATTCACAGTGCGCTGAAGCCAGAAAACTTTTCAGCAATCGCAGACCCGAGCAAGAGCAAGATTGAGTTCCGAAAGGGCA
ACGGCATCATGAAAATGCTGCAAGTCGAGAAACCCGTGTTCTCGATGCGGATGCAGCATGAGCAGGCATGCGCTGACCAGATCAAGAAGGACCAACAGAA
GGCCATGCAGCGCAAGATGTCGTTCCATGGCCCCGGGTATCGTGTGCCGACACATCCTAAAGCTGTAGGTGGTGGTCAGACCACCACCATCATCAGCATT
GAGGAAATCGACGCGAACGACGACGACAACGATGAGCAAGAAGGCGTCCTCGAGGACGAACTCGACATGACAGGCGTGGAGATGGGCATCTCCATGGACT
CCAGTGCACGAAGGCTCGCGCCGCTGCGCAACCACTCGTCGCAGGATCTGTGGGAGCCCTGGGAATTTGCGCCACCAGCAAAGGCCAAATCCGGCTGAAG
GCGTACGTGCTCTAGGCACCGCTACTATTTACTGCCACGTGGTATAGCATATTTATTGGCAGACTGCTTCTACAGGAACATTTGATAGACTTTGTGCGTC
TAGGCGCTTTCCACTTTCACTCTTGACTTAAGATGGCTACATTTTGTCAGCAAAAGAGGCAGCCAGATGTGCTCTCAGTAGTTGCCTCTTGCAGCGTATC
ACCACACCTGTTGTTGATTCTCTCATGCTCTATTGGAAAAACAAAACGTGGTTGGCTGTGCTTCTATTGACGGAAGCGAATCGTTTGCAAACCCTGGCCG
ACGACCACGACGGTATGTGCTTCCTCCTCCTCATCCTCCAAGACAGTAATGTCTGCAATATCAGCGCACTCAGAAAATGCGGCGCATTGCCATTCCAGGG
TCTTGCTGCAGCCATTGGCTGAGTCCGCTGTGATGCGCCATTTGCTCACGCGTTGGTCGTAGCCAGNNNNNNN