Description :
From Genome Similarity Track
Location :
Scaffold_666:3007- 15183
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_666-fgenesh-gene-0.0Cullin family protein
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_666-abinit-gene-0.16U3 snoRNP-associated protein Utp7
Pytiw_DAOMBR242034maker-piw_contig_666-snap-gene-0.5Inositol-3,4-bisphosphate 4-phosphatase

Sequence
12176 bases(100 bases per row)
GAAATAGAGGCTGAGTGAAGGTCTAAAAATGTATCTCCCACGCCCCTCCTTAAGTCGTTTTCACAACCCACATATCGCTTTCCACAGGGAGCTCATCCAT
TCCAATCCAATCCAACCCACAGAGAGCTCAACCCAGTCCGAAACAGAACTCTTTGAGCCAAAAAGGGGAAGAAGAAGAGCTACATTAGGATGAGCAAGGC
CATGATCGGGCTCGAGGATGGCTGGGACCAGGAGATCAAGCCCAAGGCCATCGACGTGCTGCTCGCGATCCTGGACAAGGGCTTCGACAAGGTCACGGCG
TCGCCCTTCCCGCCCAACTCGTTCATGCCGATCTACACGACGTGCTACAACATGTGCACGCAACGCTCGCCGTACAACTTCTCGGAGCAGCTCTACGAAC
GCCACGGCGGCACCTTCGACGCCTACCTCGAGAACAACGTGCTGCCGAGTCTCGAGCGCGCGCACGACGAATTTTTTCTGCAGGAGCTCGTCAAGCGCTG
GCAGAACCACAAGCTCATGAACAAGTGGATGTCACGCTTCTTCATGTACCTTGACAGGTACTACGTCAAGCACCACTCGCTGCCGACGCTCGAGGAGGCC
GGGCTCCAGAGCTTCGACCGTGTCGTGTTTCAGAAGGTCAAGGGCCGCGTGAAATGGGCCATGATCGAGCTCATCGAGAAGGAGCGCAACGGCGAGATCA
TCGACACGACGCTCATGCGCAACTGTGTCGAGATCTTTGAGGTCATGGGCATGAAGTCCCTCGACGTGTACCAGGTGCACCTCGAGATCGAGCTCGTGCA
GGTGAGCGCGACGTACTACGAGCGCAAGTCCAAGGCCTGGCTCAGCGAGGACTCGACGCCCGTGTACCTGCAGAAGGTCGACGACGCGCTCCAGGGCGAG
CGCAGCCGCGTCGCGCGCTACCTGCACAAGACGACCGAGCCGAAGCTCATCAAGCGGCTCGAGGCTGTGCTACTCGAGGCCGCGCAGAAGGAGCTCATCG
AGCGCGAGAACTCGGGCGTGATCGCGCTCCTGAAGTACGACAAGCTCGACGACCTGGCGCGCATGTACCGCCTCTTCTCGCGCATCAAGAACGGCCTTGA
GCCGATCGCGGACCTCGTGCAGAAGCACATCACGGCCGTGGGCAACGACATTGTCGAGAAGCGCGCGAATGCGGTCACGAGTGGTAACATCAAGGACGCG
AGCTCCGACCCGGCGTTCATCAAGGACATTTTAACGATCCACGACAAGTTCCGCAGCATCGTGAACGACCAGTTTGCCGGCAACTCGCTCTTCCAGAAGG
CGCTCAAGGAGGCGTTTGTCGAGTTTGTGAACAAGGACGTCGGGCCGGACAGCTCGGCGAAGCTCATGAGCACGTTCTGCGATCGCATCCTCAAGACGGG
CGGCGAGAAGCTGAGCGACGAGCAGGTCGAAGACTACCTCGAGAAGGTCGTGTTTGTGTTTTCGTACTTGACGGACAAGGACTTGTTCGCCGAGATCTAC
CGCAACCAGCTCGGCAAGCGGCTGCTGAACCAGCGCTCGGCCTCGTCCGACGCCGAAGTGCTCATGATCGGTAAGCTCAAGCTGCGCTGCGGCGCGCAGT
TCACCGGCAAAATGGAGGGCATGATGAACGACCTGGCGATCGGCAGCGACCATCACCAGGAGTTTGAAGCGTTCCTTAAGAACCAGCGCAGCAACGAGGC
AGTGTCGACCACACCCAATATGGAGTTCAGCGTCCAGGTGCTCACCACGGGCTACTGGCCGTCGTACCAGGTGCTGGAGGTCGCGATGCCGCCGCAGCTG
GTGCGCTCCATGAACCTTTTCAAGGTCTACTACGACTCGAAGACGAGCCACCGCCGCCTGCAGTGGATCCACTCGCTCGGCAACGCCTCGGTAGGGACAA
CTACACGCTTGCTATCTTATTGTTGCAGCCTGCTTGGAACTAACGCTCTGGCTCGTATGGATATGTGAATCTGTAGGTGCGCGCGAACTACCCAAAGAAG
AAGTGGTACGACCTGCAGATCACGACGCTGCAGGCCGTGGCACTGCTGATCTTCAACGACGGCGAGGGCGCGTTGACTTTCGAGGCCGTGCGCGAGTCGC
TCAACCTGTCGGTGGACGTGGTCAAGCGCATCCTCCACTCGCTCTCGTGCGGCAAGTACAAGATCCTGACCAAGCTCCCGGCAGGCAAGACGATCGCGAC
GACCGACAATTTTGAAGTGAACAAGGCGTTCACGTCGCCCATGCGCAAGATCCGCATCCCGATGGCGTCGCTCGAGGAGAGCCACAGCCAGAAGAACGTG
GAGGAGGACCGGAGTATAGCCATCGAGGCCGCCATCGTGCGCATCATGAAGGCGCGCAAGACGCTGCAGCACCAGCAGCTCATCTCGGAGGTGCTCAGCC
AACTCGCGTTCTTCAAGCCCAACCTCAAGGTCATCAAGCGCCGTATCGAGGCGCTCATTGACCGCGAGTACCTCGAGCGTGACCCGGAGCAGGCCAACAC
GTACCGCTACCTCGCGTAGATGGTGGGGGAGAATGAGGAAGATGGAGAGAATGAGGAGTGAGCCTTGATAGCGAGGGTTGTTAGCTTTTGATGAAAACAA
AGCAAACGAGAAACATGATAAGCGCAGTAATACAACACATTGGATATGGTTCTTTGTCTATGGTGAGGAATACATTTGATTGACAGTGTTATCTGATCTT
GTTGAGCTCTTCGTGTTTCTATCAGAGCCCAACTGCAAGACCAGATGCCAAGAGCGCTATTGAGAGAGACCATCAAGGCTGAGCTGCTCGCTAACGAAGC
TAAGGCTGCTTCTTGAAGAACCGGTTGAGCGCCGTGGGCGCCGACTCGGCCTTGTCGCTCCACTCCTTCTGCTGCTGCAGGCGCTCCTTGCGCTTCTTCT
GGTTCTCCACGGTCTCGCGGAACTTCTCCTTCTGCACGTCCACGACGTTCTGCTGTTTCTTGCGGAAGCGGCGCGACGGGCGGTTGCGCCCGCGCATCTT
CTTCTTGGCCGGCGCGGCCGCGGCCTCGGCGTTCGCGCGCAGCATCTGGTGGATCTTGCGCTGCTGCTCCTCGGCCGGGTCTAGGTCCACGCGGCCGATG
GCCGTCGGGTCGAGCGTGATCATCTCGGGGCGCAGCTTCTCCAGCAGCGCGCGCACCTCGGACTCGCCACGCTGCTTGGCGTTCTCGTACGGGTTCGCCT
CGTACGTGTCGAAGTTGGGCTCGCCCGAGCCCGGGATCACAATGTTGTTGAGGCCCGTCGAGTGACCCACGGAGAGCACGTCCTCGAAGGACCGGAACGC
CAGCGAGCTCACCTGGGACCCCGGGATCATGTACGTCATGTACGGCGTCGGGGACGCCGACGTGAACGGGTTCTTAAGCACGTGGACGTTCGGCCCAAAG
CCCAGTGCCACGAGGCCGCGCTGGCTCACGCTGATCGAGTTGGCCGCGGCCGTGAGGTAGTACTCGTTCAGTTCCTGGTACTTGCGCAGGTCGAAGACCT
TGACCTTGCGGTCCGCGCCGGCGGTTACGAGGTACTTGCCGCTCGAGTCGATGGCCATGGAACGAACTAGATGTGACACATAGATACAACAAACATGTGT
GAGCCAACTGCATCAACAGCCAAGCCTTTGGTGATAGCAACGAACGAGATACGTACTCGGTCCCTGGTGGCACTGCATCTTAACGACGGCCTCGTGCATG
TTGGGCGTCCAGAGCGAGACGATACCGCTCGCGTGGCCGAGGTTAATCACGGCGTTCCACGGATTCTGCGCCATCGTGTCGCAGTAGCCCTGCTTTGTGC
GGTGCGCCACGATCTGCTTGCCGTTCGTGACGTCGTGATAAGTTAAGAGGCCGTTGCCGCTCACGGTCGAGAGCAAAAAGTGGTACGACAGGAACTCCAT
GCGGCGCGGCTCGGGCACCGTACGGATGCAGTGCGCTTCGGCGCCCGTGCTGTCATAAATGTATCTGTTACGGTGAAGACAAGTCAAATAATGTTAGCTC
AATGACATCAGCGCAAGCCCATGTGTTGCAAGCACTTCGTACACGTGTTTCTTCTGCGCGGCCGCGAACATCGAGTTGTTGTGCAGGAAGACGACATCGC
GCACGAGGTCATTGGCCTGGAACTCGCACGTGAGCTTCATGCGCAGCGTGTCGAGCAGCGCAAGGTGGCCCTTCTCGCTGCCGAGCAGCATGTTGCGTCC
GTTGCGCGTGTAGCGCACACGGTAGGCGCCATAGTCCGGCAGGTCGAGGCTGAAGATCTTGCGCGCCGTGTTCTGGTCGACATTGTCCGCGAGCTGCGCC
TGTGTGAATTTGTACGTCTTCTCGAGTCCCTCGGCCTCGAGCAGCCCGGCCTCGCTGGGCAGCAGGATCTCGGACTTGGCGGCCGAGATCGCGGCCTGCT
GGTGCTTGGCGTTCGTGCGCGTGAGGTTGCCCTTGAGCTTCTTGTCGCGGATGTCCTTGATCTTCTTCTGCGACAGCGGCGCGCGCCGGTTGTACTTTTC
CAAATTCTTCACCTTGGCCGCGGAGGCTTTGCTCTGCTGCTGCGCCACGCGCTCGGCCTTCTTCTGCCCGAGACGCGACTCGGCCTGCGCCACGATCTGC
TGCACGTTCTCCGGCTCGGAGTCGCCGCCATTGTCGCTCGAGTCGTAGTCGGAGGCCGCCATCCTGTGCAGCAAGGAGACGAAGAGCTCTTTTGCCAGTG
ACGCTTTGATGCCCAAAAGCAGCGCAGCCAATGAAGCGACCCACTTTCGCTGGCATACTGTAAACAGCTCGAATAGAAGGCTCTTCTGTTTGGACATTCT
TGACGATATATTACACATTTTAGACAAAATAGTCAGATGGCGCTGACTTCCTGATTTACCCTCGTTTATGCATAAGCAGACGACTTTAATCATGTTCTTC
CGTAGTATGCTTGTGGAGGAGATATTACTCGAGAGCTCAACTCACCAACATCAGGTCGATATCTGTATATCATGCATACAAAGAGGTTTTCAGTACTTAT
GCTATCCCAAGGGAGTTTTAACACATCGTCGTTTTGTGTAGAAAGACACAAAAGTAGAGACAGGGGAAGGGTCTCCATCATGTATCGCATTGTGATTGGC
TCAAAAGAAGAATATTTACATTTATAGCTCTATCATTGGCGAAAAATCCGCGATCATGCCGAATTGATTTAATTGAACCGCGTTTCTCAAACAAACATGC
GACCTCCTTTGCAAGTCAGTCAAACCCACACTGACGCTCTCGCACACAGGCACACATGGGGCGGGTGCGTGACGACCGCTAGGCGTCTCTCTGTACGTGA
AGGTGTCGCCTACTGAGCACGTGTGTGTGTGTCTCTCTCTCTTGTGACGCCCCAGCAGCGCAGTGGACCGCGACGAGCGCTTCTGTGCGCGGCGATGGTC
GTGGGCACAGCGCTTGTCGCTGTAGCAGCAACGTATCTAGGTTCGTGGTCTCTCCTCCTTTGTAGATGACTGTCGCATGAGAGAGTGGGTATTAATTGTG
TGCGTGTGTGTGGAGCAGGACCTGAGCAAGGAGCGCGCGATGGAGAGCGAAGCGGACTGGGGCTGTCGCTAAACGTCGGCGTCGACATATCGGTCGATGC
CGGAAGTGGTGCGTGCGCCTTTCCCTGGGTTTTTTTCCATTTATAATGAGTATCGAGTCATTTAAATGGGCATGAAGGGCTCGATGCTGACTGACAGTCA
TGCTGTGTGTTTGTCTACTTGATCTGGGTCAGGATCGTCAGTTGGATACGAAGAGGACGACGGGAGCGACTGGAGCTCCTCAGGCTCGGAGAGCGGCTCA
GGCGCAGATCAGATTACGTTTCCACACGACGCGTCTGCTGGGCATTCGGACATTGAAGTCGGAGACAACGCCGACATCTTGAATGGCATCCTCAAGAAGA
AGAAGAAGGGACGGCACTCGTCGTCCGCATCGTTGTTCCATGGCTCAGGCTCCAAGCACGGTAGCCACGGCGGTGTGACAATCACGCTCCCAGACGGTAA
AGATCGAGACCGCCCTGGTTTACGCCCGAAGGGTTCGATCCTGACCCCAGTGTCCACTGCCTTACCGCACTCGTGGTCGGCGCCGTCGTTCGACGGCTCA
GGCTCCAAACACGGCGACCTTGGCGACGATACGATCACGCTTCCAGACGACCAATATATTCCTAGTATCCCAACGAAGCATCCGCTTCTAGCCCCAGTTA
TTCCACCACGTGCTGAACCTGCACCGAGTCCTTCACCGGCTTCAGCCACGAAGTCTCCGGGGTTAGCTTCGCAGCCAACGACAAAACCTGCTGTGTCAAG
CAGTGCAAGCCCTGCTTTTGGAGACCGAGAGCAGCTGAATACTCCTTCAGCGACTCCAGTTGCGACGCAGAAGCCGGTTACCTCCTCACCAGCGAAAACG
CCGTCAACAACTCCCAGCCCAGATGACGCTCTTCCAGGGGCATGCTCGTCAGGTACGTTTGTGTGTTGAGTTCAATTGTGTTGAGTTTATGACAATCTCA
CGTGCTTGCCTTCATGATATTGGGGATACTCTAGGGGGTGGCTGCATCACGGTTGTGAGCACGAGCGTCAAGGCGCTCTCGTTTACATTGACAGATGGAT
CCGATGAGAGCAGCTTGAGTGGTGCGAGTGCGGAGGACGTCGTGATTGTGGTATGTTGTTGTGTATCAAAGTACAAAAAATAGGCGTGGTGTCATGTGGT
GGACTAACGAAATCCTGTTGCTCTACAGACGAAAAAGAAGACCACTTCTACGAACTCGGTAAGGAAGGCGTTATTGTGATTGTTGGTGTTGCACTTGTCG
CTAATTCTGGTCCCCGTTTTTCTTAATCTGTAGGGTTCAAGCACCGTAGTCACGCCATATCGATCGGACTTTTGTCGGTGCAAGAACACCGAGTGCCAGA
ATGAGTATCCTGGAAACTCGACAAACGCAATGTGCGAGGCCTCGACCGCTGGAAAATGTCGCGCCGGCTACAAGATGTGTGGTAAGGTCACGTCTTCTGG
TTGCTTGTTATTGTTTGCGTCTCTGACTCTAATATTTTGAATTAATTCCGCCAACAGTGTCGACGGACTCGTACAAGCTGCAAATTACACCGACCACGCC
AAACAGTGTCGCTGACATCACGTTCACGCTGCTGGCGTCGGATATCATTGGCGTATTCCACAACCTGGGGGACCAGAGTCCATTGACGAGATCGAGCAAG
TGGTGGGTGACGATCAGCCTCCCGCAGACCTGGCGATTTGTGACATGGGAGATGACTTCAGTCGAAGTCACCTTGACTGGCCAACAGAGTCAGACTGACA
TCTCGCGGACGTACCAAGTTCGACCGTGCAGTACTGTGACGGACGTATCCAACTGTCCGAGTCTGAACTCCACCCAGATCGGATTCATTAACGTGATGGA
CCTGTTGGAGGACAGACAGGACCTGATGACGTTGGTCTCGAAAGCGCCGATCACGTTCAAGTTGACGCGCAGCGTTATCAGTGGACCTGCAGATGATTCT
ACGTCCAGCGTGGAGATCATTTTGGCGTATGAGAAGTCGTCGGGGATACTGGGAGCCACCACCACGAGTAGAAGAATGCGAGAACTGGCTGTCAACGCTG
ACCTGTCGACAGCTCTGGTTGCGCGTTCTGGCGCGAACTTGGCGGCTTTGAGCCTCGCAGCGATGAATGTCCCAGCGACTCAAGAAGGAACCATTCACTC
ATCGCTGGTGTGGGTCGATGGTGACTCGAGCACTCTCACTCTGTCGTTCTCGACCTCCACTGTCGTCGGTCTTGGGTCGGTGGACCCGAAAGTGTGCGTC
AACCTGCGCTCCTCGGCGTGTGCTCGAAAGGGACGACCATCAGCTGCCAATGTGACATTCGAGAGCCTCGCGAGCGCAGCGTACATGAAGGATGGCAATC
CGTATATCAACCTGTATTCGTCGCCTGGAGACACTCGTCTCGTCGTCGACTCTGTCAACGAGACGTACTTTTGCGTGAAGAAGCTAATCCCGTCAGGTGC
GGGGGCGAACATGTCGTGGGAGATCAACACGGACTTCACATTCCAGCTCCAGGTCGCCGGTGTCATCTGGGCGAACACAATGGACACGAACAAGACGGGC
CGCTTCTGGCTGCCGCAGCTTGTTGAGGTTGCGCTGATTGACCGAGAGGCGCTGCAAGGAACAGACTGCGCCCAGCTTCTGGCTCACGAGATGACATGTA
AGTTCGATTCTGCCTTCACTATTCTGCTGTCCAGAACTGCCCTCCTAACCAACCGTTTCCTAAACTGTGCTGCTGCAGATTCGAACCACGGTCTGAGTGT
GTACAGCGTGATGTCTGTGACGATCTACTCTGTTGCGCTTGTTGGGGCGATTCTCATCACACGAATGGTATGTTAATGTCTGCTCTTTGTTACCGTTCTC
CACTTTGCTCATTCCGCTGACTTGTACTCTTTAACTTCATTCAGAATGGCGTCACGTTCTCGGCAAGTACGTTCTTCAACGACATGACGTCGGTGTGCGT
CATCCTCATCTTCCTGCTCTCGATCATCGGCAACGCGATCTGGATCCACGTCTCGTCGAATGGCCACAACACTAACAGCAGCCACATCTACTACGTCCTG
AAGCAGATCACGATGTGCTGCACGTGGACCATGATGACCTCTGTCTGCTTCCACTGGCTGACAGTGCTCAACCAGAACTTTCGGAAGCTTCGTCGTGTCT
ACGTGCTGCTGGCGTTCGTACTGACCAACGCGGCCTTCTACACGTATGTGCTGTACGGCATGATCACGCTCACGGATTTTTTCAAGTGCACGTACAACGA
CTACTTGAAGAACCCACGATATAACAAGCGCCTATGTGAGAGTGACTACTGTCCGGATCTGCAGCCATACCAGTGGAAGTATGCGACACAGGATGTCTGT
AAGTATGTGCGCGGCTCATCGTGGTACTTCGCTGCAGTGTACGGCGGCGAGATCATGATCTTCGTGACGGCGATCGTGCTTCTAGTGTTGGGCGCCTACG
TCATTGGCCGCGGCTCGCGTCTCATTCAGCAATCCGGCGACATTTTCGACGAGAAGATTGTGTCAGTGATGAAAAGGTCGCTTCGGACGTACCTTATCGT
CATCATCGCCATTTCGTTCTCGCTCGGGCTGTCGTGCATCCTGAATGTCCTGCTGTACTCGAAATACTGGAAGATCAACGCCGTCGTCTGGTACGCGTTC
ACGATCTGGCTTCCGACGCTGATCCCTCCAGCTGGTTTCCTCGTGCTTCAGTGGAACCCTCGCCTCCACGGGATGAACTGGAACCCGTCTCTTCACGTCA
AGGACCGGTCGTTGACGAAAGACAATGTCGGCGACAGGGATCAGATGATGGAGGACGACTTCATGGGTGACACGTGGACTGGAGCCTCGAACTTCTTCGA
TTCCGAGTACGTTCCAATCGGCGCTGATAGCGTCGAAGGCAACCAGAATATCTTGGCACTATCGGTCCAACTCGTCTCTAAGGTGCCAATCGCCCACGCG
TGCTTTATCGAGCTGTACGTGGCTGAAATCAGTGAGAACGATGTCACTGGAGATGACGAGTTTGAAGACCTTCCGTCTGCCATTCGACACCGCTCCAGTA
TCAGTTCGCTCCTCCAAACCGGCGTCCAGCAAGAAAGTATGAAGTACCGCCGCGGTCAATCATTGTCGATGAGGACATCCATGATCGGCATGAGCAATTC
ACAGTGGGTTCGCGTGGGCTTCACAGAGGCAGTGCTGCCTACCCTGGTGGAGAACTCGTCGGCCGACGGCTCGGTGACGCAAGTGGCGAGTTTCCTGTCT
GTTCTCCAGATTCCAGTGATGTCAACGAACCCAGTGTTGCGCTTTGTGGTCTACGAGTTACCTGACGGGATTGTGGGGACTCAGAGCATCGACCAATTTC
CAGACGAGCGTCCCGGCCACACCAGGTCGTCTTCAATGCAGCTCGACGAGCGCGCAAAGCACGCACGTGTCTCCGGTATGGGATTGTCCCCGCCGACGAG
GCCTCAAGTGTTTTGTGAGTTCACATGCTCCTCCAGTGAAATGCTTGCCTCGGATGAGATGAACCTGGTCGCGCGTGAAGGATCGCACCGTCGCTATATC
GCCAGCCGCGTGGTGGAAACCTCGTCGTTGCGTGACGACCCGCCAAACCTCCGCATCAAGTCCATGACTGTGTCGACGCGCACGCTGAAGGAGAACAATG
GTTTCTACGTCACAAAGAGCTTCCAGTTCGCTGAGGGGAACGAGATGGTCGTCGAAGATATGACGGAGAGCGTCTTCACGAATGAAATTCCGCGCCAGTA
TCTCGAGCTTCTTCGTACTGAGCGATCTGAAGACCTTGCGCGTGCGAAGACAGAGCTCGCGAGTTTCGAGACCAAGTGCAAGAACGGTCTCATGGCCGGA
TTGTATGACAATCTCATTGACCAGATCCAGGTAAGTTGATTGCTGTTGTGGTTGCGGATGTTGCACGATCACGAGTTGATCTTTTATTTGTGTGTGTCAC
ATTCTGTGTGTAGGACGAGAATGACCAGACCGTTGTGCAGAAGTGGCTAAAAGAGCGTGTCCAGCGACGCCAGTTTTACGTAGACGCCCTTCGCGATTGC
CACAAAGTGTGCGTCGACCGTGCCGAAGATGGAGTGAATTACAAATCCAGCACGGAGAAGAAGAGTGTAGCGCTTCGCTTCCTTCCGATCAACCTAGTGA
GAATTTTTTTTTCTTGCATGGTAAAGTGAGATTCTCCAAGAGCTAACCTGACATTATTACGTTATTCTCTCTTTATAGCACGTTCAAGATATGTGGGTCG
GACCAACTGCAGACCTCCGCTCCCAGCGCTCTCGAAGAACCTCGGGCTCGGTGAAAGCGTACCCAACCATCACTGTCGGCGCCTTTGCTGCGCACTGTTT
CAAGTTCCGCCAGGGCGGCAGTATCCTGAGCCTGCGCAACAAATTGCAGAAGCGAACTCTGTCTCGCATCCAGAGTGACGTGTCTGACCGCGGTGGTGCT
GCGCTCGACAGTGATCAGTCTGACTGGACGAAGGCTGACCTTCGCTCGCAGAACGACATTCTGTGGCAGCTCACCACTCGACTGGACACGTGTGTCTCGC
AGGCGCTGACTGCGCTAGTGACCTCGTTCTGCCGCAACTTGGAACTCTCACTGCAGCATCCAACCGACCGCCATTTCCTCCGGCTAATCGACTCGATCGG
ATTCCTTTTCCAGGTGGAGAGCTTGCTTTCGACACAGGGGAAAGAGATCGGCATGCTGGAAGACTTCTCCGCATCCGTGGACGCGATGAAGAATATGACT
TTCGTGCTGGACACGTCCCCTCCGAGCCACTTGCCATCCACGCTCAACCTGCACTTGCGCAACACGAACCTCCCGAGCGTGGTGTCCGTTCGCGTGAACA
AGGGAGCGAAGAGCGGCGCGTACATCATCGTCATCGGCATCCGCTGCCAAGAGAGCGTACTGGCGACAATTCCCGAAAACGTTCGCACTGGTGGTGCGAT
CCCAGTCACACCAGTACTTTTCACGCAGGGAATCAACGAGATGCAAACGCTGGCGAACAACGCGAGCGGCAAGAAGACGCACCTGCAGGACACGATCAAC
CAGAAGAGCTTCCGTGTGCTCACTGCGTACATTGAGGAGTACAAGAAGCTCGCGAAGATCAAGGTGGGTCTTTTATTTTCTATCCTTCGGTTGGTTACGG
AGATGTCTTCTTTTCTGATTGCTCACCTTTTCGAACTCTGTGTTTGATGCTGACAGCCTGATGCAGTGCCGACGCCCGTGTCGTTCATCACGCCGCTGCT
CACATCGCTCGAGGAACGCATCGATACCGCTCGCAAACAGGTCGTGCGGACGAAACACCCGAAGATCATTCAAGAAAGCTCTCGACTCTGCCGTCTTCTC
GGTGCCGGCCGTGTCACTTCCTGCAAGAGCGCCAAGGACCGCACGGGCATGTCCGTGACGCTGGAGCAGATCCAGCTACTCTGCGAGCACCATGGCCTCC
CGCAGGAGTTTGTGATCCGCACCGTCTCGACCATGCGCAGCAACGGCGTGCGCCTCGAGAACGCGTTCAAGAACACGGGCAAGCGCCAGTACGCGTTCAA
CGCGCTCCAGCGCTCACTACTCCCCGAGGAGTACAAGTGCCCAGAAGGGACCTACGGCCGCGGTCAGGTGAGCTAG