Description :
From Genome Similarity Track
Location :
Scaffold_32:300692- 309821
Transcript NameFunction/comments
Phyca_LT1534549380phosphatidylinositol kinase (PIKL4) putative

Sequence
9129 bases(100 bases per row)
cttacaaaaatggcatccatccgatgtacatctgcgcgaggttttcgtgcgatgtcgcctcgtggatgagtttatcgacttggccttgcactgagagtgg
caacgtttcaacttccggcaagatactgcggtgcgagttcgacacaagtgggcggatgccgtcgcccaggttgtaaatgccgcgcagtcgaccgtcgatg
gacttgaggacaaggcgaatctcttgcttgctgcgctcactggaaagctcggcgggagttttaccagagctagcactgctttgtgtagctttgccacgac
gaccccactcgacgagagggtcatgaatgaaggattccagcacgctacgcagagtcgccttattttctcgcagcaattgcatcgtcacctcgcttacacg
acggaaaacaccctcgtaccccgtgatcccaaaggcatcaataatgttgggggtcagacggaaaggaacgatctcaggcttgttcagtttgaggcctttg
tcgaatagacagtcaaagtctacgtgcacgcactcaccattggtgcagtcaatcaaaatgttttctccatgacgatctccgaggccgacaatgtgcccca
ccatggaccacacagcagctgaccgcgtgaacataagtcgagcctcgaaccatgcagtcgggtcagcgaaattattgtagaaccactggtgaaaccttgg
cgtgaagacaggcattgacagaatcttccggcgataataccgcgccatggctgaaggatcattggcaaactttttctgcatgttcatatatcgctctttg
atgtcacttgtcagtcggacaggctgtatgtacccacgctctgtcttgtgaatctgcccgataagctgcctcatcgtcttcgtgtttcgaacccattcca
ttagtccactttcttcattcagacacaccacggcatatgtgcgcagtcgcaatttgcgcttgcggccttctctgtctttctgaagcagtttgttgatcat
cgaattaaattccatcatacgcgcgtccttgcgtagatcaccagtcttctcacgcttgcacaagaaggagtatagcttaccatcggttcccataacttcg
atgcgctttggcttttccttggtcatcatcacttccgccttgtcgctaaaagattttatgtagacctgcgcatttgccgaaaacgcaacgtgatgttcat
cacgaggggcaaggccagatggcggcaggatagtggttagcgctgcttgggtaggaactagaattctagtccgaatccgagtcaggcgaatatgaatctt
gcgttggctatttccaggatcatgtgcagcgagacttataagttcctcagccattttcactgcctcggaaaagctgtccgcaatttcttttagtccctgt
gacaacaactgctgctgcgcactcgcgataacctcacgtgcacgatttcgacgctgggagttcaatgatcgtgaaagaccaagtagtgaccacatcgctt
gcgtcggataagccaagagcactcgaaccataattctcttgacgccatcgactacaactggattgggatggcatatgcgtgaagttacttgaggaaaaca
cattagccattcgtacgctggaagcgactcggtggcttcatcgataactttagtaatgtcaacgaaaaccttcttctcatccgtggactgactcatgccg
atctcaatctgctttagagccttgttcgctttattgccaggccttccactgttggctccgtataacacttcaccaaactcaaaccatagcgttagcagtc
gtggaagcgactgaaacacgaactttgttccgtgtagcagagatagcgcataatttttcatcaaattaatcaaatgggtgtgaaacaccgaatcgaccag
aagatcagcagcttcgtcactactcaatgatccgctgagagcgtcagggtggctcacactcagcagatactcgtaatatttggccaggtaaaagtatccc
ttttcccatgtcggatcaaaatgaataactgcttggtatcgctcgatcacccttttcccttgacgctgacccgacttctgcatccagttggttgccaaaa
gcaggttcttggcacaaaagtgggggtcctcgacatcaaagtcaagcgtagatgcgtcaatatcgactggttctagaatttgcagcgcctcatacattcg
gtcctggctcaccagcagcttggccttctctattactgcatacggattgtccattgattgagcgtgcatcgctgcactggtggcagtacgaataaagcct
tcttttcgggataacttagcgtagagcagccagttttctgatacttcattttgtaaccctgcctcgtgcaaaatcactcgtcgtagcgcaaggatcggct
cacggtatttcagctgtgttgccatcgcatcataccgtattttccatggggtctgctttttccagaaagcactgcgtcgaccaaggtcttcacactcctt
tgttttctccaaaaagatgaatccttgctctgcttcatgcagaaaatgaagatcatgtagtagtgggtatgcacgttgatacgactcagctgacgctgct
gctagaggccccatcacgtccaatcgtgctgctcttaaatggcgctggaattcttctttctgtccaccatgcaggctatgcagtacacgaaccatcatca
gctgcgagacatcaaagccctttaacagagtggaaggcatgccgtcagaggaatttcccgacgaacgcaacagtgggctctgtttctccgcactcaggag
atcggtcagtagctcccatctagataatcgccaagagcactcaagtgcgtatggatacatcgtagccatcagaagtggttcttgagttattatcccattg
atatgctgtaacgcgctctcgagacgcccaagttgaataagacagccgatcattcctccatatagctcaggctttatcacatcaggatctttgagtgcat
tttccgcatccaaaatctgcggcggaggctgcaccgtcgcgaattgactgtaatgtggtctgctaagtggcatcgatctggacgataatgcagactggat
ctcttgaattgcttgctcataacatgccagcgcatcttcccactgtgcaagctgctcatgatcgacaatttgatgcattaaatcagtgagacccagtccc
ttgtttttaactcctccttgcgtgtctggaccagcctcgttttgtcggtatgtttcgtgcaaacgacgcaaagtagccaacccgatcagtgcatcaggct
cgtccacacttttgtaaagctgttggagataagttgcattattcgaaaccagtgaaaggcgaatcgggcctgccacctcaacattagtactccttgcttc
tgtcgcttgaaattcttcctgccgtaaatggacttcaaagtattggatggcccgtgcgtacgctttgatttggaatgccgcattcgaaagcgatcgacta
ggaatgcccttaataaactcttccaagtactccttttcacggtcatcaatctcggaggtcatgtcgctccgagcagaagccgacgtttgtcgacttgcag
cactggcactaagagtaagacgtttcttttcactagtccaaatccactcgttaagctcatcgaatgtcgaaaaaatggtttgggaacactggtcatggcg
acgaaaaaattcaccgacggatggttcaggcgcaccaccagtgctcgtaagtgaatcgttcatgcactctgattcgggaggggccattaacacatcgtcc
atcagaacaccacaatcttggtcatccaaaacggccatgacttctttcttaagctcctcccctacttcggatcttccggaccgaagtacattttgtatca
aataaggcaatagaaaccgggatacctgaggacatgttgggagtgcggttttgcaagccataaaaatcttcctctccggtagttgagaaagatgaattaa
tcgacgacaccacatcagtatccattcctcatacgacgtcccatatttctcgtaaaacgaaatgtcgtcgagtggtagatgctggttccgatctgcgctt
gcaggtgattgatgatgagatccactatgtccattgcgacgtgaagatctaccgcttgatacggtgtagtttgttgaccaataaggttcaacaaactgta
aaacatcttttcgttcgaatcttcttttcatccactccggcataggggcgctgggatctcttctagtcttgtagggtggaccgatattgttagttgccaa
actttgcccgctatgctgcggatccgccgtcaattccgccagaaatttcagtaattcttgaattgcaaatcctaacgagtcggtgttctcaggtgctgca
cgcagttcctccaccaacaatgtctcattagtacacaagctaaatctttcgtcgaatactcgatcttttggaacttcttttcctttgcgactgctcctcc
ttggggtccagaagtgtaaaacatattcaacgggacgcgggcgccatcgatcgcaccaagagcacccagacaccgagcgcaaagtagcttgataggttca
tggctctctgtacgtgaaagtgttaatatacattgcaccacactagcaaccgatccgtcaataaatatgtctccttcattttgcatcagcgcctctaatt
cggcaccacgcacaaccaaacaacgtagcagctgggtcaacgccatttcacgaactgctacgtcgcgatcattgacgtattccgataaattcatcaaata
atcacgtaaaggtcgggatctaaaatctccttcttcctcgtaaaggacagcgaaaatctcatcaagttctgggatggatggtagcaacgggatcctagga
aaataaggttttaaatcagctcccttctcgataaacaagtagcgtaaaattcccacagccgctgccatgcacctcgtctcaacgtcacttcggttgcctg
ctggtttgagttgtccaaggttatcacgcccaaaaatctccagagactcgacattccaacattggctatcaacattagacccgtcttcaattaaaattcc
agagatttcttgaccgaggcatgggagcaagctgacaacgatggagcttaagttcgcctctaaagctttcgtcgacagcattcgcagaaaattgccccat
gcgtgaatggcatgctcctgcaattccacttccgtgagtcccacttttagagttgccatcacctttgggacaaacgggtcgacggccccattattctgcg
tgctactcgggtctgtggaggaactgctatacagctccaacaagcagtcaatactcttgatcgcgcgaatcttcacagaggctaagtttctgccactaat
tttattgcctagatctgtcattatagccaagaagtactggcggggcatgcatgcatcaggctgtagactcgcagtttgctcaatcgcttccgcaccccgt
gaagcttcatttaacttggccgccacttcgcgcatcgctcgcttcgccattcgagaccgaggaccaccaagttcccaagccaataaattcgttagtctca
acggagcgtgtgtaattaaatcacggacagtggtattttctggcagaaatctaaacaaaaattcccattcggcaatccgggtttggttcgagactgcttg
cacatggcgaatgagcatatctcgaagcacatactcgatatgattcagcagcaggctcgtgatattaatctgttcttcgtcagcaccagtatcagccatt
gtaatatctcccccggtttcattgaactcagcgacgtacgcacgtaacattcgctcattttgctggacgacacattttgggaggacatacggagcacttg
ctttcaagaagactatcgtatctacttttcctttcatgaacgtgcggagaaacaatttgagattcccagtttttagcaattcgtcaatgagagaaaaata
aagtagttcagggaattcagtgcacaactgtgtccactccactcggtggtaccttgtaatacggtaaacttggccgtaagccattgctgcgtaatgcgag
cgattcgcattcatgtagtggttccacagagataccaagcgtaaaagtatccacatgcaattatccccgcgacctctttgctgcgggtcacatccacaac
caattgaacccaacgcctgcatcgtagcagcaataacgctaggttcgttgctcaattctgccgttgatgtacgaatctccaaccgctccattagccctac
gagtccgtccttcgcaggatcaatcattgcgtcaaggaggcggggctggtggtaaactgaccccaggactgcttttcggaggggctccgaccgactgtca
aaccacattaaaagactctccacgaatttcatagcggtctcattggtcccataatcaatctcacagtgctcaaacacactcgatagcgcgttgattttaa
ccacttgcatattttcaacagaggcgcctgtttcgtcacaaattatgggctcgaacaacgcgagtggaatcggcatcgtttgacggtctgtagacatctt
ccggcattggcagctcttcatgtgccaatgcaaacggggattttgaatgtcgcttagttgactgtctcgttcagcacatgtttgaccaaacgctgcagcg
caaagcacagccccgcatgcttttgttattgccaacgaaactgtttctgacgtcgttcgttgtattttcccactaaaagcttccatgatgcaagtagtaa
tctttttgggggaggttactgattcagacaccacaaagaaagcaagcagaggggtcaacgcgaggtaggtgcacactaccacgtcgagtgaagtttcttg
caaaatcgctcggtacgcaaccttccatggcaaggcgtttcgccatgaatcttcgtcagaaatatttagcgtcacagggcgagaccacacaaagtaaacc
aagagcgggccgcgaagggccacaggcttccgaaaaatactatcgagcacagaatctgcactacgaagataatcgtatgatacagcgtcaggcctcacta
atggagctaagtcgtggcacttcgggtggcgttggtacagttctagcagttccagatactcccagcagtctggtactataaaagactgatcccgttcaac
ccttcgttcaaagagcccctgagtctctacactctccacaactttcgccagtaagttacgatacttctcgagctcgtgatcgtcgaaatatcgcaacaaa
attatccataaatccacgtattcacttgtaagtgaggcgagtgagggtgcgttcgtgttcacaatcaaatcgacgcgctgcagaagtgatcgaaatacgg
caaagctttctagacgaacaaaagagacaatgtagcgacgaagaggcaagatcacccgcaacacggtggaaattcccacaatactcttccggtcgctacc
attcccaacggagatgagatcaagtatccatcgacccagcttttcgtgtaactcgatgttgttttctcgacgcaaccgtgaggatggacactctctgctc
gcagataaatcacttcgtttccgtttctttggtgcactgggatattgacttaaactcaccgtattcatttcctttgatataaagcgaatcacctttgcca
gcaattccttcgctgatagcatacgatgaatgccagcaattacccgggatgccactgcaggattcgaggcttttagatcaaagttccccaacacatccat
aaataacgaagcgggggataaagtgctggactgacaagtgtacgtgtgcaaaactgaaaggacggatatccaaaacaactccacactgcctttgctttca
cgactagccccgcgtcccagatccatattcgcaaatacccacgattcaaaagaaggccataggacatcggcggcgatgttggaaagacgaggaaaaagct
caccgattaactcgataatggcggcacacgctttcagtatccgtgggttagcttcgtgaagatctctgacctttaaaaacatcaccaccaagccaacaaa
ccgtctttccatagagatgctggcctgcagcagcgtgtgtagtagtcgaaatgtgcttcgagtaatttcactcgcatctaggtttgagacagagccatcc
atgtacaccgccacatcagcacctttcacgagcttctcatttttaacgataaaaagccccacaagttggcatagcctgtctacggactggtgtccttcga
gtatcgccttatgctcacgaattatcgactccgctagaataaccacagattgccgcagagccaccactgctctatacgaaccaatataaatagatggcaa
catccgcttcagctgttctctgcgttcgtaaacctggttcgtatcagtaattggcatacacccgcacaacgcaacgttgcttttcgctccaagtggtcca
tccgcatcctggtacacgtgaatcgcagtatccagatagcacgcgatagtagctccatctccatcagccaaaacatccaacgaacctctgtcctttaacg
actcctccaccaagaaacagtcctctaggagcagcacagtatcacggaagaagtgaacaaagccatacacgtcattcttctgcagaaacaaaagcatctg
caacgttacaccgcgaacatctctctgtgcctctttcagtgattcgttcgtgtagaacgataccatataaaacagcatcgtagccattgtcgggaaagac
gggaaccccgcggccaccgggttgttgcctcgtgccacgccggtatcattctccatgaaaagcgtcatcgaatgaggacacgctttaccgctcagcaaca
gcataaggagttgacataaatccttcagcacaggaaccgccttgtcggtcgccagagtcgccacaggacgcatgagcttgggtagaagtttgcgtaactt
ggtcagcatcgtcttgcaacgtgtgatggctgcaggggcactcgaatcgtatccacggtcatcatgttggtgctggtgggcgcgcacaatccgtagcaag
ctgtccacgtcgcccttctcagcgtcatc