Description :
From Genome Similarity Track
Location :
Scaffold_37:30067- 31456
Sequence
1389 bases(100 bases per row)
ATTTCTCGTTTAACCGTTTCTTTCTTTACCATTTTTACGCTCAAGCCACAACTAAGCATCCCTATCTATGAGGGTAGAATTTCATTTATTAATTTTGTTA
TCTTCTTCGCAAGAATTATCTGATATTGTGCGGTGCGGAAGAAATGGTTCGTGCATTGTGTCCAGCATAAAGACACTACGACACTGATCAGCAACGGCAA
TTGACTTAACTACCACCTCCATATGATCTCACTTGGAAAGTAAATGTTTCGTCGAGCTAAAGGTTAATCGTTCCATCGATCTAGTGGGTCTACCGCGTAC
TTAATTTTTTCTATGTCATCCGGCTTTCTCTAATTATCATGATGTCATCTCAATAGACTATAAACTAATGTATCTAATAGGCAACTAGCTCTGCATCGTC
ATCACAGTATTATGATTTTAGCATCTTTAATGAAGTATTGCGCGAGGTCTATGCACTAAAAGCTCGCGCATATTTATACAAAAGCATTGACCAACCCCAT
TAAATAGTATGCACTTGTGTACAATCTGGATGCTCTTTGCCACCTTAAACTTGTTGTACGCATCACAGGTATGCGGCTTGGGCTGCACGTGAAAATTGGT
AATTACTCTAAGCTCACAATTGTCACCTCGTCAAATACCTTTCACACCGCACTCGACCAGGTATATGAATGTTTATTAAGCCCAGCATGACCTGGGCTTA
GAATTTAAATCCATACACACGTCTTGATAGTGTGAACCATTCTATAACGTGCTGGGGTAGATGTAAATGGAGAAAATTGCCAGTTAATATTTGATTCGTA
GATTAGTTTGACTTACTTGCACTTAATGCATCACTATATGTAATCCTAGCGTGTTCTTCCAAACCAAGACCATCTTCACTTCCATCAACACTGTTTCGTC
AAAATTATAGAAATCATTCGACGACAAGGCATATATTGTTTACGCATTAAGGAGCAACCGTGTGATCAGGCGTTCTTGTCTTTCTTTATAAAGAATATGT
GCTCATTAACGTTAAAAATCTGCAGATACATGAATGCATGCTTTGCTCACCTTGGTAATGAAAAGTGTCAAGTTAATAGCAGAAATAGAAGTGACAAGCT
TTTCTTTCTTTTAGTATCAGACTCGTAATTATCCGCGTTTTCGTGGATCCTTCTTCCCACGAGACGCAACATACTCAGCCATTAGGCTATTTTTCATTCA
ATAGGACCTATAAGGTTTCCATTTGTTTCTTCAGCTTTCCTATCGCCATAAGCTTAATTTCATAACATTCGAGCTACTCTCTATATCCTTACCACCTGAC
CGGACGTAGACGTCAGCGGGAATGGCATGTCTTCTCAATTTTTACGTACATTTTCGTCTTTTTAGCTGCATGTTATGCTTGTTAATGAA