Description :
From Genome Similarity Track
Location :
Scaffold_213:30061- 31207
Sequence
1146 bases(100 bases per row)
TGAATTTTTCAGTTCTTAACGTCACTGAAACGATAAGATAGTGCTATTCTGCAGTTTTTCGTGAATTTATTTATTTCTCAATAGTGAGAGCCTTGTGTGT
TCTATGTTTGTGTTGCCCAACACGATGCCATTCTGTGTGGTTTGTCAGTTGTATGTGTGATGGAGCGTAGGTCTATGTATTATGGCTCTGTTTCCATCCA
TTTCAATGGTGTGGTTAAGGCAAAAGGAAGAGAATATGCGGTAGTTATGAGCTGTTCTATGGCTTAACACCCAATCCAATCGGTTTTAAAAAGTGGGATC
TGAATCGGATTGGAAAAAAAAGCTGACTTGGCGCAGATCTATCTCACCTCACATCCCTGGGAGCGCCGCAGAACCGGAAAGTTTCCTTTGCTCAAGCATG
AAGTTCATGACCAGCACCTAATCAGACTGATTGGATGCGATGCAAGAACAGTGCATGTTGTCGACAGCGTGCCTGGCGAGTCTCCGTGGCCACCGTGGAG
TTCATGTTTGAATAGCAAACCCCATTCCGGTGGCTGTGCACATGGATACAAGCAGAAGGTAGCAATCAGGATGTCTAGAAACGAAAATCGTACGCTGCCA
AGACAACGACACTTGCCTGCCGCAGTGAGTTCCAAGAGTGAAGCGCCTGGTTTCAGCAATAGAGGCTTCAGGCGATACGCAAGCCCTGACGATTGCCAGC
AGAATGTACGGCGCGATTTGTCGTCGTAGCAGGTCTGAAGCGCAAGATCGCGCGCAATGACCTCGAAGTGGGCCATGCAGTTTGCATCGCAAATGCCTGG
TCGAGCTTGGCACGGTGGCGAACACCGTCGAACGGTGCTGACCAAAGCGGAGCCGACCCCATCTCCGAACCTCGCACGAGTAAGCAGCACTGCGGCCGTC
GTCCAACTGGCGCAGTGTAGGTTGCATGCTCATTCCGACGGGCTTTGCCCGCCATGATTTCAGCGACGCATCCTCCACCGCATTGAACACAGGTGGTTGC
GCATCACCGCCGTCTAGTCCATTGACCGCGCCGAAAGGAAACTCGGCCAGGCTGAGCTTGCTGTCGGCTCGGAGGGCCCAAGCGCACACCCAACACTGCC
GGTGCTTTTGCGTTTGCAGCCTCTCGCCGGTCTCTGCCACGTCAGA