Description :
From Genome Similarity Track
Location :
Scaffold_712:3006- 10427
Sequence
7421 bases(100 bases per row)
ATCACCTATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCC
GACAAGGATCTCGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATC
CAAGGGAACCGGGGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAACTGGTGT
GTTCGAAGCAGAAGATATCTTCCAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAATCCATCACCGGAGAAAGGTCG
CGCACTATGGATCCAGTGTCGTTGCCGAGGATTAGCCACGCTGCGTCCTCTAACTACGAATCCGTGGCAGAGGATTGGTCAGACACGTCGTCCGAGCCAC
GACGCATGACTTTGGGGCCCTCCAGGGCATCCATGCTGGAAGTGCGGGCGAGGATCCCGGGACAGGAAGCGCCCTCGAGTGTGAAGACTCGGGATCCAGT
ACGCCCTACCCGTGATCTGATACAATCCAACCAGGATCGAGCCAGATCCAGCAAGAGGCCAGTGGGGTTATCGTCAGATCGCGTTCAAGGTAATCGCCTC
ACGGATCCGGTCTCGCCAGTGAACCAGACGGCTACAGGCTCTTCCGACACCTCCTCGGGCACCCTGCAACGACAATTCGAAGCTGCGATGAGTCGTTTAC
TGGCCGAACAAGGTATGAGAGCACGCGGGCCGCAAGCGCAAGTGTTCCACGAACATGAAGCTTGAGACGTGGAGATGGAGTCAGTGGAGGGAGACAACTC
CCATGATGAGTTCGACCCAGATAATCTGGATGGCCCATCCACTTCACCAGCGGCGGTAGCAACAGCCGCAGCCGGGACGGGTGGATCGTCCATGATCCAG
AGGGTACGGATCTCAGCCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGACGAAGACCGAGCGCAAACATAGATCAGCAAAGTCAAGTCGACCC
TCATGAGAGATCAAGCGTCGGATACTGAGAAGTGTCTGATCTTTGGGATCTGCTAGCGGGGTCAGCCAGGAATTGGTATCGGCAGCTGGGCAGATCCACC
AGGAACAAGTGGCCGGATTTGCTGCGCAGCTTCCAAACCCAGTACTGTGGATTGGAGGTGTCGGTGGCACGACAATACTACCACGCTCGCCGCAGATCGG
ACGATCCCCGCTGGAATATCTGCATCGGCTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATTAAGAATGGGGGATCCAAGGTACTACGGGAACATGTG
GATCATTTCATCGAGACGTTGGGAGATGTGGATCTGGCCGACAGGCTGACCCTGTTACGTCTTCCAGACGCAGATGAGCTTGAAGAAGTGCTGCGGGCTG
TGGGTCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGCCCACGGCTCCAGCTCGACGTGTCCACCA
AGTCACGGCGCCCGACTCAGGAACTGAATCAGGATCCGACGGTTCGGACTCCGACCCAGAGGATTACCGTCGAGTCTGTCTCACTGCATCCAACGAATGT
ACGGCGAAGACCGGAGACAAATCTCGATCGGGGGATACCGTATCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGACAGCGCAAATCA
GATGCTCGCAGTGTGGACCCCGGAAGCACACAGAGTCTGGATGTTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGCCATCCCGGAGATCATTT
CTTCTACGTGTGTCGTGGTTGTGGCGAGATTCACGACGTCGGCAAGTGTCCGATGGAGGAATTCTACAACCAGATCCGCCAATGGTTTGACCCAGCCAAG
CACAGAGGGATGTTGCCAGAAGTGGCCGAGAAGATATTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGATCCTGGTATTGCACGTA
TGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAAATTCAGTCGATAATACACGTGATCTACATGAAGTTTCAGTTGCCAAGATTTCT
GGTTTGCGCCAAGTGGACAAGTTTTCCAGATCCGAAGTCTCTTCAACCCTGGATCTACACAGGGGAGAGGCACGGGGTTATTGGGAGAAACGCCAACATG
GTAGATGGTTTGAGCCTACCAAGGGTGAGGCCACCGCAGATCCACCCAAGGTTTGTCAGATTACTGGATCCCGGGGATCTGAAGTGGTTGGATCCATGGA
TCTGCTGACAGGGAGGTCTCGTGGATACTGGAAGTACCATGCCCCAGGAAAATGGTTCAGACAGACCAAGGTAGAAGGCAAGATCAACAATGAAAAAGCG
ATCCTATCCCTAGATTGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTG
TTGGGATTGGTGAAGGCGTGTACCGTACAAACGGGAGAACGCGAATCAAGGTCACGTTGGCAGGTTGTTTGGTGTACTGGTTCGACATTTGGGTTGGAGA
CCTCGCTGGTCAAGACGCCATCCTTGGGATGGATTTCATGGTACCAGCCGGAGTGAGGTTGGATATGGCGGATGGGACACTATGTTTACCCGACGAAATG
CGGATCCAGCTCAGCGGACGGCGACTGTTGTACGGGTCGAAGATGAGGATCATAAGGGCGAATAAGACGACCTGGATCGAGCCCGGAGAGACCTGGGATC
TGCCACATCGGTTGAAGTGGGTAGAACATGATAAACAGTGGGTCACTCGAGGTGAAAAGTGGGTGCCTAGAGTAATCCAAGGACCAGGTCGATCGCAATA
CCTCCAAGTCACGAATGTCAGCGACAAGAGACTATTACTGGACCACTATGAGGAGATTGGGCGATGGTTGGCGAAGGATGGTATCCCTAGGCGACCTGGA
TATGTGTCCGTGGGGTCCCGTCGCTATAGAGAATGGCGGAATCTGGCGTATGAAGCGACAACCGAGCCTGAATCTCTCGGGGAGGCGGAACTCCCGGCGG
AGCCAACTGGCCCTTTGGTGGATCGGCCTTCATACCCAACTCCGCGAAAGAACCTACATAGGGATCATCGGATTGGGATCCAAGTGGTAGAGGTTGGATC
CAAGACCGCTGGTGATACCCAGAGCCAGTCCCTAGGTAACCAAGGGTCGGTGGATGGGGGATCGCAGGGAATTCAAACTGGTCCGCTAGATCCTGCTGAC
CCACAGTTGGACCCAAGCTTTTCATTGGACAGAGTGCCTGGATCCTTGCCGAGAGTGGCAACACTAGCCAAACAGGAACCGTCGTGTGTAAACTCACCGG
AGGATCAAGTCGATCCAACAGGTAGCTTCCCCGGTACCAGGATACCCGACCCCACGAAGACAGAAGGGATGACGGTTGAAGGAGAGTCGCGTGCTTGGAT
CCAAGGGTGGATCCGACAAAGACTGAAGATGAACAAGTCTGCTACCATGAAGGCGGGGATCTACACACCGAGGATCTTGGAGAAGGCATGGCCGTGATCC
CGGAGGTACCACTGACCACAGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAAAGAATCCGCGGAGGTGGATCGGCTACGTCAGAAGAT
CTGGGAAAGCCGACATCTGCTGATTGGCAAGGAGATGCATTACCACCCGCTGTCCGCGGAGTCAAATGTGACATCGATGTCAGTGACGAGAAGCCGATCG
CTCAAAGGGCGCGGAAGGTAGCGCCTCAGTTCCGAGAAAAAATATCGGATCTGATTAAGGGCCTGCTGCAAGCCAAAATCATCGGTTTCTCAACGTCCCC
GTGGACATCTCCGGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTAGTTAACGGCCTGATCCGATTGATGGTG
TATCCAATGCCTCTAATCAATGAGCTATTGATAAAGTACTCTGGTACTGTTCTCTAGATATGGCAGGTGGTTACTGGGTGGTGACTATGACGGATCGAGC
TCACGCAATATCCGCATTCATCACACCGTTTGGACTGTCCGAGTGAAACCGGATGCCGTTTGGATTGAAGAACGCACCCAGATCTACCAACGCCGGATCG
ATAACGCCCTCTATGGAATCACCCGAATACCGGAACCCGAAAGGGGTGGATCCTGGGAAGATCATACGGAAGTGGATCCATTCGAAGCAGGAGAGCCGGG
GGATCCTGGGACCCCGTCTGTGTTGGGGCGCAGATCCTATATCGACGACATTCTAATCCCGGCAGAATCGTGGGATCAGTTGTGCGAGAGAGTGACATCC
CTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGCGTGGTGGAGAGCTATTGGGGGGTGCGCAAGGTGGATTACTTAGGTCATCGAGTCTCCAAGG
AGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCGTTGGCAGACTTGTCCTTCCCACAGTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAACTA
CTACAGTCGGTTCGTCGCGGATTATGCTGCAGTACTCTATGAATTGAGGGAGGTAGATTTTGCTGCGATGACCACTTCAGCTGTCCAGATCAAAATCCAA
CAAGCTATGGCCCTGAAGATGTCGGATCCACAAAGGAATCCAAGTAATACGACGCTGGCAGACGACCTAAAACAGGAACCGGATCCACCCCGGGACCAAC
TGGGAGAGGATCCGATCGGGACGGGCTCGACGGAGGGGATCTCAGACAAAGTGGAGCTTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAA
CAGGATCGCGACCACGCCTATCCTCCGTCATTTCGATCCGGAACGTCAACCTACGGTTATAGTTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTA
CAAGAACATGAGAAGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGC
TCCTGCGCGTGTTGGATCTGAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTGACCCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGG
GTTACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACACTGGAGATTGTGAAATGTTCGAAAGGGGAAAACGAGATCCTGGGAGTCTTG
GCCGCGAGCATCACACCTCGAGCTAAGATGGATGAAGCGCTGACTAGGATCGCTCCTAAGAATAAACCCAAACGCCGGATCCAGATCCCGATCCCAACGG
TACAAGTGGATGAGGATCTGTACGTACTTAGTTTCGATGGATCCGCTCGCGTACGACGCGAAGGAGAGGTATACAGCGCAATACTGTGGAAACTGCCGAA
TGGGAAGTGTAAGAGCCAGATCTACTTATGCGGAAGGCCTCACCGTCAATGAAGCGGAGTATAACGGACTCCTGCTGGGTTTGGATCTACTAAAGGGACA
GGATCCAAAAAGTCTGGTGATATGTGGAGATTCAAACTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACGCTGTCACGG
CAAAAGGTGATGGTCCACCTGCGTGGTTGGATGAATCACGAGTCGGTACATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGTGCCGCTT
TACGGAATCAATGTGGTGTTGAGGTGGAGAGCGAGGCCGAGCATCAGGATCTCGTCACGCTGAACCGACTAGACGAGGTGGTGGTGGTCGGATCCGGGAA
AAGGACAGTCCAGGTAATGGCTGTCACTAGGTCCAGAGGAAGGATTGGATCCAGCCCCCAGATCCTCGAGGAAACATTTGTGAAGGGAGTCCGCATTGAG
CGGATCCGCAAAGCACAGAACGAAGAAGCGTGGATCTTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAGGATACCAAATCCT
ACAGTATTATCGCTACGGATTACGCAGTGGATCTGAACGATTTGCTCTTCTATCGGCCCCCTACGAAGAGAGTCAACGAGGATCGGAATGGATTGATGAG
ACTGGTGATGCCGGAAACCTTACACCAGGAAGTCCTACATCACTATCACGCTAGTTTAGAAGGTGGACATCAGGGTATTGGTCGGACCTACCAACGGATC
CGGGGATGTTTCCACTGGAGGGGACTATTCTAGAGCGTGCAACGATATGTCGGTGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAG
GGGGGTCACCTGGGAATGTCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCACATCCCCTCGTTGCCCAAGTCGTTCAAAGAAAACACAGAATT
GTTGATCTGGGTGGATCGGTTTACCGGATACGTGATAGCCAAAGCTAGTGCGTCTAGGACTGCACAAACCATTGCCGAATCGTACGAGGAGTGCGTTTTC
CGATGATTTGGGGCTAGTGAGATGATTAGGCATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCTTTCAACCGGATCCTGGGGCAGAGACAGC
GGGCAACCATGGCATATTGTCCCCAAGCTAACGGATCGGCCGAGCGCATGGTGCAGACGATCACGAGGGCACTCAAGATGTATGTCCACGATTTGGATCA
GAGGGATTGGGATGAGTACGCAGAACGACTTCCCTTCGCGATGAGCACCGCCCAAGACAGGATCCGGGGTGACACCCTCATTTTACTTGGTACATGGCTG
GGATCCTAAATCCACCCTAGAAGCGGCCATTCCGGTATGTAGTACCAAGAAGAGAAACCGAGATCCAAGACGATGGCGATACCAAGTCCAGAAATACTAC
CGGCAAGCCAGATCCCAAGTGAACGAACGGCTGCGGAGTGCGATACAAGATCGAGCGGATCGACACAACGAAGACGCTCGTCCCCATCAAATCCAAGTAG
GATCGCAGGTGTGGCTTTATT