Description :
From Genome Similarity Track
Location :
contig_31:300566- 301712
Transcript NameFunction/comments
g7174.t1hypothetical protein

Sequence
1146 bases(100 bases per row)
TATTTTGCACTTGCACATTTATTTTTGTGGTTAAAACACTGCATAATGTCGGGGTAATTGTCGACATGCTTCTAGCTGACATTGATCCGTACGTGCATAG
TGATGTGGCCACCGTCCGCCGCACGCGGGATCCACAGCAGCAATGACCCGCCACCTGAGCCTGGCAAGCCGAGCAAGCCAGGCCGCCACCGATCGAGGTA
CATGTTCTTGTCTTGTAGCTCAGGGACGGTGGAGTCCCAAACCACCGTCTCACCTGCGCCGACGTCCACTTCGGCATAGTCTTCTCCACCCGTATGAATG
ACCACCGTCACATCCTCCTTATCCGTGCTTTCAAAGATAAGACGAACGACTCCGTCACCCGCCTTGGTCCACGATCCGTAACTACCTTCGAACGCCTCAT
CCACAGTCATGAGACCCAGCGCATCGTATAGAGTGCCATCGTCGATCTCGCCAAGGTAGGCGGTGGGTCCACAAATGGGCTGCACGAATTGAGACGCCAA
GTACGCGATCCCTGTGGGGTCGACCGTTGAGAGCACGACGAGGCCCATGTTCGAGACTTCGAGCAAATACTCGTCTTCCGCGACGGATGCCCCCATATCT
GTCGTAGCCTTCTCAATCAGCTGGTCAATAATCACACTGAACGTTCTCCGGAGTAGATCACGCGTCTCGTAGGCTGCCGAGATGGTCTTCGTGGTTAGCA
ACTCGGCCATACAGTTGTTGGTAACCGCAGGAATGTCATTTAGCACAGTGGGGGACTTGTACACCGTCACTCGAATGTCATTGACGGCAGCGTTGGGTGT
GTCATTGCGAACGTCGTTGACAGCGTAGACGACGCGATCTGCGAGACGCTTGAGCTCCCAGCCACACGTTGAATTCTTATCGATGAGGTCCTGAAGTTCG
TCCGTCGTCGTAGACGAATCGTTCAGTGCACCACTACCTGTGAGCATGTTCAGCACATTCCCCCCCGTCGACAGGATTTCATCACCATTTGTGATGGCTT
GCTTCACGATGCCTTCTACGACCGTCACCACCATGTCGATATACTGGGCCTTCTTCGGGACAGGCAGGCCAAGGCAAGCACACACGGCGACAGGCAAATC
AATCAGCACGACATCAGACTGATAAGCCACCGCCAGCAGCTCCTCT