Description :
From Genome Similarity Track
Location :
Scaffold_1116:3005- 7838
Transcript NameFunction/comments
g17784.t1hypothetical protein

Sequence
4833 bases(100 bases per row)
CCCTCGGCAAGAGCCAAACGAGATTCTGCGCTTCCTCACGGCCAGGTACATATCTCCAGTTGAAGCCTGTATCCGCTTACTCGACTTCTTGATCCAAGGA
AAGACACACGCAGTCACTCAGCTTACCGTTCACGTCGAAGATGCCCAAACCGTGTTCTTCAGAGCGACGGAAGACCCGGAGCGTGTCCTGGGTCGTGGGA
ATCACACCATGTTGACCCGCTTCTTCGAATTGTGTGCGAGCGACGAACCCGAGAACCAGATCGCGAAGACAATGCTGTACCAGGATATACCCAAGGAATT
CCGCTGGATGGGAAACACGAAGTGCTGGGTTCGACGTAAAAGGTACCAGGCTGCAATTGGTCGGATGGTGCATGTTTCACCGCGTGATATGGAGCGCTTC
TATTTACGCCTGCTATTATGCCATCGCCGAGGACCGAGGTCTTTCGAAGACCTGCGGACAGTTGATGGTGTGCTGTGTCCCACGTATCGAGACGCGGCTG
AACATGCCGGCTATCTGGAGAACGACAGCGAATGGGTTTTGTGTTTGTCGGAGGCTGCCGAGTTCCAGATGCCGTACCAGCTGCGCCAGCTCTTTGCAAC
AATCTTGGTCTACTCGGCGCCTACGGATGTTCGGGGTCTTTGGGACCAATTCTTCAAAGACCTTTCGCTTGACTATGCGTACAGGAACCGAGAGATGTTG
GACCCTTTTAAAACGTCTGTTGTGACGTTCGACACACTGAAGAGTATCCAAGACTTGCTCAGTGTCAGTGGGTACTCCGTCCAAGACTTTGATCTCCCTC
GGCTGAGCGAGTTCCCTCGCCTGGTGCTTGAGTCTGTTCTGCAAAACAATCTCATCCGACGAGAGCTAACGGGATATGACGCGTCTGTTCTTGAACAAAT
TGTGAGCGAGGAGGACCACCTAAACGAGGAGCAGCGCTTGACCTATGATCAGATCACCCAAGCTGTCGAGGACCCACAGGAAGGCAGGAAGCTATTCTTC
GTTGATGGACCAGGCGGTACCGGGAAGTCGACACTGCTTCGGAACATACTGGCCAAGGTTCGTCTATCCGGAAAAATTGCAATCGCGGTCGCTTCCAGTG
GGATTGCTTCTCTGCTGCTTATGGGAGGTCGGACAGCGCATTCTACCTTCAAAATCCCCTTGAAGATAGACGGCGAATCTACTTGCAACATCAACAAGCG
ATCCCAGGTCACGGAATTGATGAGGAAAGCAAGTTTGATAGTTTGGGACGAGGCACCCATGGCGCATCGGCACGCGTTTGAGGCAGTGGACAGAACGCTT
CGTGACGTTTTGGATAACGAGGCAGAACCTTTCGGTGGGAAAGTCGTTGTGCTTTCGGGAGATTTCAGGCAAATTCTCCCGGTGGTGAAGGGCGGCTCGG
CGACAGAGACAATCGACGCATGCCTGAAGTCATCCGAACTGTGGCCACTTTTCCAGAAGGTGCGTCTGACAGAGAACATGCGTGTTCGCACGGCTGCCAC
CTCCGATAGTGCTGCAGAAATGGCTGCGTTTTCCGAGTACCTGCTGGAGGTTGGAGAGGGGAGACACGAGGTACACAACGATCTGGGAAATGACTACATT
AAGATTCCACGCGACATGCTCATCGACAACCCCGCCGGTGATCCAGATGAGGACGAGGAGATCCGACCGGGAGCTATTCCGCGAGGTATGCGGCGCATGA
TCGACGAGATGTACGCCGACATCAACAATTCGGAAGTCGCAACGGACGAGTACTTTGCGAGTCGCACCATCCTCACCACCACGAACGCGATAGTCCATCG
TATCAACGAAGCCGTAGCGGATCGCATGACTGGGCCAGCTCGAGAATATGTGTCCACGGACTCAGTGGAGGATGACGAGGACGGGAACTTATTCGAGCAG
GAGGTGCTCAACTCCCTGAACATCAGTGGCATCCCACCCCACAAGCTGAAACTCAAGAAGGGGATGCCGATCATCATGATGCGGAACTTAAATCCCGACC
TGGGGTTGTGCAACGGAACGCGTCTGCGAATCGTCGAACTCAAAGATCATGTCATCCATGCCACCATCATGGCCGGCGACAGACAAGGCCAGCATGTGTT
GATCCCGCGCATCGTGTTCATCAGCGATGGCGACATCCGCGATTTCCCATTTCGACTGAGACGCAGGCAGTTTCCTATCCAGACTGCCTTTGCCATGACG
ATCAACAAGGCGCAGGGACAAACGGTGCAGTACCTGGGACTGTACTTGGCGACTCCTTGCTTTTCCCACGGTCAGCTGTATGTGGCCATGTCAAGGGTTA
CGTCGAGATCGAGATTCAAGGCGTTGGTCGAGTATCCAGAGCGGAAGGAAGAAGACGGAGTGTACACGGCGAACATAGTGTACCGACAGCTGTTCGAGAG
AGCGTAGGCAGCGACTTCGTGTGAATGCATATTTTACGAAAGAAATACATTTGTCACTTTGCATAGCGGTAATTGTTGAGAGTCACCATTCCCCCTCGAG
CGCAGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGCTAGACAAGCGGAGGCGAAGCTTGC
GAGCCGTAGAGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGAACGCCTGCGGTTTGATGTCCGTGTGCGAAGCACGCGGGTG
AAAACCCAGGATCAAACAGTGCATGGTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGGACCACGTGAGACGAG
CGCAGCGAGTACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGCTAGACAAGCGAAGGCGAAGCTTGC
GAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTG
AAAACCCAGGACCAAACAGTGCATGGTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAG
CGCAGCGAGTACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAGTGCATGGTAGACAAGCGAAGGCGAAGCTTGC
GAGCCGCAGCGGGCTTAGGGTTCATGGAGACGGGAACCACCTGAGACGAGCGCAGCGAGTACGCCTGCGGTTTGAACCCCGTGTGCGAAGCACGCGGGTG
AAAACCCAGGACCAAACAGTGCATGCTAGACAAGCGAAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTTTGATACAAGTCTACTGTAAAATATACT
GATATAAAACATAAGCCTGTCATAGCAAAAACAGTAGTGAAGCGAGCTGGATGAGCGAGCGAACGGGCACCAACCAACCATGCACCCACCGCCCGCAACG
CGGGCGGCGCTCGGCTAGTCTCCTACAAGTAACAGAGTAACCTGTCCGTCCGTCCGTCATTCCGTACGCACCCGGAGCGTAACGCAAATCCGGACTTTCC
GTTGGCTATAAATAGCTGCCGAGCGCAGCGAAGGCGGCCTCCCCATTCGCCAATATTATAATTTGAGGCCTCTCATTGGCTATATAGTGGAAACTCTGCG
CGATTGGCTATTATAATGCGTAGTGTGGACTACACCACATCGGAAGTAGCGGACTGAAATCACTGATGCTGATTGGACAAAATAAACCGCCTTTCAACGA
CGCCTGTCTTTCCACGAGTTTCCCACGCCTGGCGCTTCAGTCCGTTCTGCAAACATCTCCTACAAATAAAGAGTAACCTGTCCGTCCGGTCCGTTCGGTC
CGTCTGTCCGTCATTCCGTACACACCTCGAGCGTAACGCAAATCCGGACTTTCCGTTGGCTATAAATAGCTGCCGAGCGCAGCGAAGGCGGCCTCCCCAT
TCGCCAATATTATGATTCGAGCCCTCTCATTGGCTATATAGTGGAAACTCTGCGCGATTGGCTATTATAATGCGTAGTGTGGACTACACCACATCGGAAT
TAGCGGACTGAAATCACTGATGCTGATTGGACAAAATAAACCGCCTTTCAACGACGTTTCTATTCACGAGTTCCCACGCCTGGTGCTTGAGTCTGTTCTG
CAAACCATCTCCTACAAGTAACAGAGTAACCTGTCCGTCCGTCCGTCCGTCCGTCCGTCCGTCCGTCCGTCCGTCCGTCTGTCCGTCATTCCGTACGCAC
CTCGAGCGTAACGCAAATCCGGACTTTTCGTTGGCTATAAATAGCGCAGCGAAGGCGGCCCTCCCATTCGCCAATACTATAATTCGAGCCCTCTCATTGG
CTGTATAGTGGAAACTCTGCGCGATTGGCTATTATAATGCGTAGTGTGGACTACACCACATCGGAATTAGCGGACTGAAATCACTGATGCTGATTGGACA
AAATAAACCGCCTTTAACAACGCTTCTTTTCACGAGTTCCCACGCCTGGCGCTTCAGTCCGTTCTGCAAACATCTCCTACAAGTAACAGAGTAACCTGTC
CGTCCGTCCGTCCGTCCGTCTGTCCGTCATTCCGTACGCACCTCGAGCGTAACGCAAATCCGGACTTTCTGTTGGCTATAAATTGCTGCCGAGCGCAGCG
AAGGCGGCCCTCCCATTCGCCAATACTATAATTCGAGCCCTCTCATTGGCTATTTAGTGGAGCCTCTGCGCGATTGGCTATTATAATGCGTAGAGTGGAC
TACATCACATCGGAATAGCGGATCTGAAATCCA