Description :
From Genome Similarity Track
Location :
Scaffold_60:30047- 33501
Sequence
3454 bases(100 bases per row)
TGACATGTTTACGAACGGGGAACCAGACAAATCATCGCTGGTACCTGTATTTGGTCGACGGTCGTTTGTGGATAACATTTGCTTCGGTGGCGAGGATTTC
GACAGCTGCCTGGCGACGTTGGACCGATTGCTGGCAAGATTTGCACAGTGTCGGATCAGCATTAGCTTCACCAAGAGCATCATCTGCCAACCTAAGGTGG
ACTTTCTGTCGCATAAAATTTCGCCAGAAGGTATCAGAGCTGACCCCAAGAAGCTTGCGGCTATCACCGAGCTTTCGTTTCCAACGAGTAAGAAGGGCAT
GCAGTCGTTTCTTGGAGCGGTTAACTACTACAGTCGCTTCATTCAAGACGTCGCGGTCTACGGTGCAGCGCTGTACCAGCTCAAGGATGAAGACTTTGCC
GTTGAAGGCGGCCTTTCTGTGACACGTCGTTCCTTCGAAAAATTGAAGACGAGTGTTTCACATTCACCCATCCTCAGGCACTTCGTTCGGTCGAAAGCAG
TTCACGTCATGCTATTTGCGAATGAATGGGCGTTGAGCACTACGCTAATGCAAGAACATGAGGGCAAGTTACACCCCGTACGGTTCCTCGGTCGGGTGCT
TAAGGAAGCCGAGATGAGCTACCATCCTGCTGAGAAGGAAGTTTTGGCGTTACTGTTGAAGATCTGTTACGTCCAGCCGGCAGGAAAGACGCTACATGTC
TATACACGATTCTCGACGTTAGAGTGGGTGCATAAGTCGAAGTCTCTCTTCGGACGCGCGGTCTAGTTCGCAGTGCTGCTATCGCAGTGGCACCTGAAGG
TGCAGCGCGTGAAGGAGAAGGATGTCGCCTTCGCACAGCTCCTCCAGTCAAGCATCACGAGCTTCGTCGACCTGGAAGACTCGCTCGCGCCGGTGGCACC
TCCACACAAGGGTTCCCCGACTATTAGAATGGACCCCGCGTTGCTGTACGCCAGGCTTTCCCGTAATTACAGAGGATTCGTCAGGTCTTTTGACGGATCA
GCGAAGACAGAGAAGTACGGTGGCTACGGGAGTTGTTCATGGGTGCTGTGGAGCCTTCCTGAGTGGAAGGTAGTGATTGCTGCAAACGCTTACCTCTCGG
CTACCACGGTTAATGAGGCAGAGTATACAGGTATGATAAACGGTGTCAAGGCTGCTATTGCGCACGGTGCCGAGGATTTGGTTATCGTTGGTGACTCAAG
GCTCGCGATTCAACAATCACTAGGGGTGATCGCATGCAGGAAGGAAACTTTGCTAGCGCTGCTGAATACTCACAAAGAACTCACGGCCAAGCTTCGATCA
GTTAAATATCTTCACGTTGTACGAGAATACAACGCGGCCGCGGATTCGTTAGCCACTGAAGCGCTGGAATCGAAGGTCAGTCGGGTAATCTTGGCTGAAA
CTCGCAAGTCGGAATTGGCATCGCTGAATCGCATCCAGGAAATGATCTACGAACCGGATGAAGACTCGGTAGATGTTTTGTCACGTGGAACAGAGCGTCA
AGTACATGTACTGTCAGGCAGCGAATCTTCAAAGTGGAAAACTTTCGAAAAATTCGTGGTTGATTACAGCTCACCAAAGTGCGATTATGGTAATATGGCA
GTGATGACTCGGCGACAGACGAAAGCCAAGAAACGCGTCAGGTTTGCAGATGAACACTTAAAGGATGTCTCAAAAGCTCTAGAACAGCATGAAGAACGAC
GAGAGACGTCCACCGAAGATTCATTCGGCGAAGATTTGCCAGACCATCCTCACAAGACTGTACCAGCGGCATTTCCCGATGCGGAAGATGTTGACCCGGT
AGCGATACAGCAGGAACAACGCAGACGGATACAGGTGGCACAAGACGAGGAACAGAAGTGGTTCAACATCAAGAAGGTGCTTCAGGGCCAAGCACAAGAG
CTGAGTTATAAAGAAGCTCGAGATGCCTGGAAATACGGTGACCGGTTCGTGTTATCAGAAGACGGCGTGCTTCACTATCTTGGATTGAATCGTCGGTACG
ACCACGGTTGGCAAGAGGAGACCAAGCTGCGGCTTGTGGTACCGACAACGATGATTTAAGAGGTCTTGCAGAACTGTCACGACTCGCTGGAAGGAGGACA
TCAAGGTTTGGTGAGAACGTTCGATCGCGTTAAGTCCGATTATTATTGAATCGGCTTGTACGCTGACGTGGAGAAGCATGTGAAGTCATGTCCAGATTGC
AGCTCGAGTAAAAGCCGTCCACAGCTTCGTGGATACTCACCTGGTAACGTGCTAGCCGAACGACCTTTCCAGATCGTCTCGATGGATTTTGTGATCCCAC
TACCGAAATCTCGTAGGGGCAACACAGCGTTGCTCCTATTTCAGTGCTCGTTCACGGGATTCGTTATTGCCAAGGCTATGTCAGATACGACTGCACTGAG
TGTTGCCCAAGTGTTCGAAGAATGTGTGTACCGACGGTTCGGAGCCCCATCATTAATAAGGCATGACCGCGACCCACGCTTCATGAGCGAGGTGTTCCAA
GCGTTCGCAGAGATGATGCAGTCAAGATCAAGAGCGACTTTGAGCTATCGGCCACAGGCTAATGGTTAGCAGGAACGCTCGGTGAAGTCAGTGATGGGGT
CCGTACGGGTGTACGCGGAAGACCCTCTACAGCAAGATTGGGACGAAATCGCGGAGAAGCTAGTATTTGCTATTAATACTTCTCAAGACACTACGAGGAA
GGAAACGCCGTTCTATCTCGTTCATGGTTGGGATGCGCAGTTGACGTTGCGGGCAATGTCGTCATCACTCAAACGAGGACTCGGCAAGCAGTCTGACGCA
CTGGCGTTGGCGGCGTGAGATCAATCGACAACATGAGGTCGCCCTCACTATGGGCCAAGGATTATCAGGGTTGTAGAAAAGGAGCGAAGGGCTAAAAAGC
ATAATGATGCTCTGAGTCGACTGGAAAAAGCTGCTGTACCTCAACCAAGTGGAAACGAACACTCGGCGGACCCCTAGAAGCTTCAGAAGAGATAGAAGAT
CCTGCAAGAGCCCCACCGAGATCTCTTTTTGAGATTGGGAGCCGGGCGTGGCTGTACATGGAACGCGTCAAACCGGGCTTGACAAAGAAATTAGCTCATC
GATGGCATGGACCTTTTCGGATCAAGCGCAAGGTGGAAGCGTTTGCGTACGAGCTGGAACTGCCTGACCGAAGTGGGTATCGCTTCTACCCAGTAGTGCA
TGTGTCGAGACTCAAGGCTGTCAACGAGTTCAGCAGTCGACCGAACACTCGGTTGGTACTAGACGCGACTAATGAAGCAAGACTCGGCTTCGATGAGGAA
CTACTGCCTGAAGATAGCTGGGAACCAGATCAAGTTGCCGGCGAATATGAAGTCGAGGCCATCCTCGACGACAGAACGCCACTGACGACGAGCACGGAGC
GTGCTGTACGCGAGTTCAAAGTCAAGTGGGTGGGCTATGAAGATACAACTTGGG