Description :
From Genome Similarity Track
Location :
contig_15:30040- 35067
Transcript NameFunction/comments
g3963.t1RAW24142.1 hypothetical protein PC110_g19429, partial [Phytophthora cactorum
g3964.t1hypothetical protein

Sequence
5027 bases(100 bases per row)
GGCGGAGTGAACTTCTGCACGATACCGCGGTCCGCACAGAACTTGGCCATCGCACCGGAGGTGTACTCGCCACCGTTGTCGCTCCGGAGTGTCTTCACAC
GCTTGCCGGTCTGAGTTTCAGCAAACGCCACAAACTCCGCGAACTTGGCAGCCACCTCGGACTTGTTCCTCAGCAAGTACACCATGCAGAAGTGCGACTT
GTCGTCGATGAACGTGACGAAGTAGCGCTTGCCCCCAAACGTTGGCGTCTGCATGGGGCCGCACACATCGCTGTGAACCACCTCCAGCACTTGCTTCGCA
CGGTTCGGGGACGACTTCATGTAGCTCACTCGCGTTTGCTTGCCGAGTGCACACCCGTCGCACAGCTCCCACTGCTTCACCGACGTCATGTCGATGCCAA
CACCGTAGCTCTTCTTGACGATGGCGTCTAGACCGCCATGGCCAATGTGACCAAGTCGGAGGTGCCAGAGGTACGACGTGGTGTCCCCTTGGCGATCCTT
CGAACTTGCCGCATTGGCCTCGTCAGGCATCATCGGAGTCATGCACAGCTTGAACAGCCCTTTGCCCTCACGAGCGCCGAGCTGCCACTTGAGACCCTTG
TTGTCCGCGAAGCACCCGTCGCTCTCGAAGGTCACTGGCCCGACGTCCTTGGTGAAGCGGCCGACCGTAAACAGGTTGCGCGACAGCTTCGGGATATGCC
ACACATTCGTGAGCACCCCCTTCTTCATGCCGCGCGGCGTCTTCATCGACATGACAATGTCGCCGGTCCCCACCGCCTGAACCACACCGTCGTCCGCGAG
ATGCACGTCCACCGGAGCCATCGTCTTGTAGTTCCTCATGTACGTCTTGGAACTCGTCATGTGCTGCGTCGCACCCGAGTCGACCAGCACATGTCACTCG
GCTTGGCGGTACTGCTCGTACGACCAACCGAGAAAAGGTAGTCGCCAGGATCTTCTTCGTCCTGCGCGACGTTCGCACGCTGCGACCGATATCGCTCAGC
GTCGTTCTGGACTCGCGAGGGACACTCCGCGATCCAATGTCCTTGTTTGCCGCAGTTGTGGCACGCCCCGGTCTTCTTCACCGGTCGGCCCTTGCGTTTG
TTGTCTCTCGTCATGAACGCTTGACCTTGGCCGTGCGCGGCTCCGTCGACGCCGCCGCCACCTTGTTCCTTGCGCTTCATGTCCTCATGCAGCAGCCGAG
ACGTCACGAGTTCCCACGACAGCGAGTCGGCTCTCGACTCCAACGCCGTGATCAGGAACTGGTACGACTCGCTCAGACTGCCCAGAAGCGTGATCACCAA
GTCGTCCTCGCTGACCGGAGCGCCAACCGCGTCGAGCTGCTCCGCCAGCGTCTTGAGCTTGTTGATGTGCTCCAGCACATCATCACCTTCGTCATCATCG
TCGTGAAGAAACGCCGACGAAGAAAGAGCTTGTTGGCCAAACTCTTCTTCTCGAAGTGTCCTTCCAGTCTTGACCATGCATCATGCGCGTCCTTGGCCGA
GCGAACCAGCGGTAGCTGCGAGTCCTCCATCGCGAGACAGATGATCGCCAGCGCCTTACGCGACTTCCTCTTGAACGTCGCTTGATCCGCCGTGGTCGTG
CAGTGCTCCAGCTTCACTTCCCCACTCGTCACTTCCCACAGTTCGCGCTCCTCGAGCACCATCTGCATCTTGAACTTCCACGTGTGGAAGTTGGTTCCGT
TGAACTTGTTGATGCGGGCGGTCGTGGTCGGGGTGGCGTCCATGGCGAAGGCGTAGTCGGGGTCTTGGTCTTGGGCAGGGAAGACGGGGCTTGGGCTCAT
AACCAAAAGGCTTGGTCGCTTGATGGCAAAATGCAAAGTGATTGATTTAGGTCCTTAGTTCGCAAACTCCCTTGCTACCTCTAAGCCTACTGGATTCTCT
ACTGGATACACTCTACTGGATTTCTTACCGGATACTGAGTTGCTTCAGCCAATCAGCGACTGCCACGTGGATGCCCATCTTGTACCCACAATCTTGTACC
CACGTGTCCCGTAATCCCCGTAGCGTAAATAGCGCCCCATCATCAGTGTCCCGCGTCCCATCATCAGCGTCCCGTCAACACAGGAATGATTGCGGTCCCA
CTGAGTGAAGGTCATACCGGTATCCTACCGGTATACGACAGCTGCCCGAGGCGCCTTCTTGACAATATGTACCCATGTCTATTGAGGGTATGGAGGGTAT
GGAGGGTTACCGGTTTGGTATCGGTTGTTTACCGTGAACCGGTTAACCCGAACCGGTCCAATCCGAACCCACGCCGATTACGCCACCGACGATTACGCCA
CTGTCGATTACGCCACCTGTGGGTACAAGATTGTAGGTACAAGATGGGCTTCGACGTGGCGCTCTCTCATTGGCTGAAGTAACTCAGTATCCAGTAAAGA
ATCAAGTAGTGTGTATCCAGTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGCTAAAGACCTCAATCAATCACTTTCGAATCTTCGTTCTACCCCTCAAGTG
GTTTCCAGTCTCCGCTCCGGTCTCGCCCAGAGTGCTGCCCTCCCTCCGCTCCGTCAAGCTTCACGGTGTCCAAGATCCATACCTTCCATCAGGTTATGAG
CCCAAGCACCATGTCCTCTGCCCACGACGCCTCCACCAAGGTCTCCATCGACAAGTTCAACGGAGACAACTACGCGACGTGGAACCGCTACATGCGTGGC
GTGTTCCTGACCAAGTCGGTGTGGCATGTCGTGAACCGAGAGACGACGCCGAGCTTCACGGACTCGCGGCCCAAGGACGAGTACGTCAAGTCGAGCAACA
TCGCGTTCGGACTGATGTTGCTCCACATGGACGCGGACTACCACCATGTGGTCGACGACTGCGAGGAAGCGTGGGTTGCGTGGACGCGCCTGAAGACGCT
GTACGGTGGTTCGCAGAAGGCTGGTCGCATCTACCTGAAGCGCCAACTCTTCAGCATGGAGATGTCGGAAGGCGGGAATGTGACGAAGTCGATGAAACTT
TCTCGCCCAAGTGTATAGCGGTAGCCTAGACTTAGTCCTGAAACTTAAGCCTGGGGGGTGTAAACCCTGAACGCGGTTCCTTGAAACCGTGATTCAGAGT
GGCATGGCACCTTGTGTAATCCCTATCGGCGTCGATTGCTTCGGGGGAAGCCCGGATATATCACTACAATGAGTTGTCAAATACAAATAGGCCTTGAAAA
TGCTGAGCGTAACGTCCACTTCCTGAACGCACTTCTCCAATGTCTGGAACCGGTATCGAGAACTCGGAACAAACACCACTTTCAGATACCCAATACAAAT
ACAGAGTTATATACAACACGCAGCCGTTACTTATTCTTATAGACCCTTGAACGGTGGGTCTGAACACCAGTCAACTAAGGCTGAATCCAGGATACTGGTC
AATCCTGAAGCCTTTTCTTCACACGCGCACCACCCTCAGATGAGGGAAATAATACACACCAATACAATCCTATCTCAAACGCAGTCTATCAAATATTCCT
GGGGATGACTGCTACTATCACCCAAGAAGGCCTTGTTAATATGAAATGAAAACCCCGCCCTTACCGTACGCGCAGCGGGTCCAACTAATATAGGGAATGC
AAGGATCACGTCAAATACTTACGTGAATGATCCCCTCGCAACTGGGCTTGAATCTTGTAGAGAGCCCCGCACCGAACTGCCCTTAACTGAACGGCGGACC
CGTGTCCTGCTTGTCAGAAGCTCACTTACTTTGAGCGACTTGCGTAGTAGGGGGTTAAACGAACTCTGATTGTTATCTTTGCTAGCCATCGCTAGCTTCT
TCGTAAAGGGTATCTGTCTGTCTTCGTTCTTCTGTTTCTTCTGTGTTCTTCCGTGTTCTTCAGTGTTCTTCTGTGTTCTTCTGTGTTCTTCCTGGCGACC
TTCTGACTTTGACTTGGCTTGAGTATACTGGCTGTCACTTCGTGGGTTCACTTTCCATCTTCAAGGAGTCAAATCCTCGCATTGGGTTCTGGGTGTCTGA
ACGTGGGTTCTTCAAACCTACTTTCAAGTTACTTGACCTTGAACATCATTTTCAGGTTCCAATTTCTTGAACGTAGATACTTCAGACTCACGCTCAGGGT
TCTTCAACTTGGACATTTAGCTGAAACCAGTGTGTACGACCTCACAGTACAGGATAGTCTTGAGCACGTATAATACATGCGTTCAGACATCCGCGTTCAG
ACATCTGCGTTCAGACATCTGCGTTCAGACATCCGCGTTCAGACATCTGATGTGATCAAGGTCTCATGACCAAATCATACTTCATTGTGAGTGTCCACAC
GGCATTTCTTCAACGGGCTTTTTGTTTGTCTGGCGTCTGGTGACTTACGGTGCACTCCGGGTACACGGACATTCACACGCTCAGGCTTTAGGCAAGGCGG
GACACCATATGTGATACATTCACATAGGCATTTTCAACTCCATTGGGTTAACCCGCTTAAGGACGGGGTTGATTCAGACATAGATCCAGTTTCAGGCTGT
TTGGAGCCTAATCTGACCTTCCAAATCTGGGGGGCCCATCTTAAAGCCTGAGCGCATCCGCTCCGCGGAACACAGCCGAATTCCACATTCAACATGCGCA
ATGCGCATAACCAGTACTCAAAATTTTCAGTAGCCAATCAAATATCAGCACATATCCACGTCACTAGTCACCCATTGATTCCAACCGAGAAATTGCACTC
AGTCTCGTGTCAACCGTCCCTTCCGGTCATGGTCTGTCAAAGAGGAACTTTCCGAGGAGAGGCACCATGTCTGGAACTGATAGGAGCAGGCTTGAGCCTG
AACGTGGTTTTACCGTTGCTCGGCAACTTGCGCGGGCTCAGCACCTTTCTCACCCTTTCGCTCCGGGTCTGCTTTTCAGCATTGTTAATTCTGGACTCCA
TTTCTTTTAAGTCACACTCACTTCAAAAATAGCGTCTGAGTCACAACTGCCCCAGAGTCATCCGTTCTTCAATTCCGGTTTCAGGTTTCTCTCACTTTCA
CGTTCAGCATGTTCATCACTTCAGGGT