Description :
From Genome Similarity Track
Location :
contig_31:300383- 301433
Transcript NameFunction/comments
g6100.t1hypothetical protein

Sequence
1050 bases(100 bases per row)
GGGATCCACAGCAGCAATGACCCGCCACCTGAGCCTGGCAAGCCGAGCAAGCCAGGCCGCCACCGATCGAGGTACATGTTCTTGTCTTGTAGCTCAGGGA
CGGTGGAGTCCCAAACCACCGTCTCACCTGCGCCGACGTCCACTTCGGCATAGTCTTCTCCACCCGTATGAATGACCACCGTCACATCCTCCTTATCCGT
GCTTTCAAAGATAAGACGAACGACTCCGTCACCCGCCTTGGTCCACGATCCGTAACTACCTTCGAACGCCTCATCCACAGTCATGAGACCCAGCGCATCG
TATAGAGTGCCATCGTCGATCTCGCCAAGGTAGGCGGTGGGTCCACAAATGGGCTGCACGAATTGAGACGCCAAGTACGCGATCCCTGTGGGGTCGACCG
TTGAGAGCACGACGAGGCCCATGTTCGAGACTTCGAGCAAATACTCGTCTTCCGCGACGGATGCCCCCATATCTGTCGTAGCCTTCTCAATCAGCTGGTC
AATAATCACACTGAACGTTCTCCGGAGTAGATCACGCGTCTCGTAGGCTGCCGAGATGGTCTTCGTGGTTAGCAACTCGGCCATACAGTTGTTGGTAACC
GCAGGAATGTCATTTAGCACAGTGGGGACTTGTACACCGTCACTCGAATGTCATTGACGGCAGCGTTGGGTGTGTCATTGCGAACGTCGTTGACAGCGTA
GACGACGCGATCTGCGAGACGCTTGAGCTCCCAGCCACACGTTGAATTCTTATCGATGAGGTCCTGAAGTTCGTCCGTCGTCGTAGACGAATCGTTCAGT
GCACCACTACCTGTGAGCATGTTCAGCACATTCCCCCCCGTCGACAGGATTTCATCACCATTTGTGATGGCTTGCTTCACGATGCCTTCTACGACCGTCA
CCACCATGTCGATATACTGGGCCTTCTTCGGGACAGGCAGGCCAAGGCAAGCACACACGGCGACAGGCAAATCAATCAGCACGACATCAGACTGATAAGC
CACCGCCAGCAGCTCCTCTGTAGTAGTAATACTTAGCACATTGCGCCGGC