Description :
From Genome Similarity Track
Location :
contig_69:30036- 31912
Transcript NameFunction/comments
g11624.t1hypothetical protein

Sequence
1876 bases(100 bases per row)
ATTGCGCTTTCGCGCGAACCCCCGCAGTCCCTCAGAAGTGAGGGTACCGGCAATCACGCCTAATACGGGTTTGCCGAGGGTAACCTCGGCGGGTAGTGAA
ATACACTTGGGAACACTCGGGTTCCACCAATATATAGGGACCGACACTCCTTGTCGCCCCTAACTCTCGGCCACTCCTATCTCTTGGACTGACCAGCAAC
AAACTCTCGGTTCAATGTACCTCAAGCTCGCTGACAGGCATCCCACGCAGCCGAGCGTATCCAGACCCTAAGACAAGCTAGCTAGACTTACCGAAGACGG
ACTTGACCCTTGGTGGCTTGTGGGGAAGACTGCTGATTTATTTCTCTTTATCCTACAGCTCTGGGAGCCTCTGTAGGTCATCATTTGGCTAGTCCTATAT
CTCTATACAAATATCAAGTGTAAACAGATCTCTGTGGGAAATCGTATAGCCGGCTCTACACAGCCGAGGGTACGACACCGAAGTGGGTACAAACGAGGTT
TTTAACCTCGGCCGGGGTTTTATTAGACCCAGCCGAGACCTCGGTCACTATTGTTCCTAGGTCACTATAGCGCGGGAAATGAGACCAGCCAATCAAGACA
CTCTGTCGCCGTTCACTGAAAGGTGCAACGTCCGCCGGACCTTGACTGTTCGGCTCCAAAACCCAACGCCACAACTGCCCCCGCCTCGACGCAAGCTCCC
GCAAGTAGTGCGCGTCGCGGCGCCTCTTGATCGCACCCCGATGGCTCGCCGCTCGCCGTTGCTGAGCCGAGCTACGGCCGCCGCTCCTTTGCTCTCGACA
CCTCCGAAGAGGTTCGTTTCCTGTCTCTCTTTCCTTCTTCATGCTCCTCGAACCTTGTTTGACCCTTCGGTGCTTGCCTCCATCTTTATCCACGTTCACA
GGAAGCTAGCGGCACTCCGTCCGCTACTTCTGGCTCCACTGGAGTATCGGGGACCGTTCCTCGGTCGCCGGCTGCCACTCCTCTGGCTGCGGGCGAGGGT
GCAGAGGGTTCGTCCCCACCCACGCCTCCGTCGGCTTTGGTGACGACCCCATGGGCTGCCCAAGCTTCTGTCGCTCGTGTCCCCGATCAGCCGAGCGTGG
AGGAGAAAGGTGAAGACACTTCCGAGCATTCTCGAAGTCGCACTCCCGCTTCGGCAGCAGACAGCGAGTTGGCCGCTCTTCAAGGGTCGAATTTGGATGT
TTTGGCCGACATCGCGTCGACACCTGAGGTCTAGGCTTCGGTCTGGCCTCATCCATTTTCCACGTTCGTTCCTCAAGCTGCCAGTGTGCCGTCCGAAGCC
CGTAGTCCTCCGTAGCGGCAGTTCTTGAGCTCCAAGTAATTCCATTTAATCCAATTCCATTCGAAAATCGTTCACGTCACATGTAAATATGCAAATTCGA
TGCAGTAGCAGTTTTCGTCTGTCACTGCGGGCTGCATCATCCCCGCAGGCAGTTCATTCGTCAACCGACGTCGCAACCAGGCCTCGTCAGAGGCTTGGTA
GCAATCAATAGTCGGTCACTCGCAATTTTGATACAGTAGCAAATTTCATCTGTTGCTACGGGCTGTATCACCCCCGTAGACAGTTCAACTCTCGGTAGCT
CTCCAGATTAGTTCTCGTCAGCAACTTGAACCATCTGCAATCGTCGTTCGCTGCGCCGAGTCCGCAGATAATCATAAAGTAGCCCCCCACATGATAAATT
TGAGGCAGGCTCCCACGTGGGCTCATCATACCCAATCCACTTCACTTTGAACTCTCGGACTGCTCGTCGACAGCGGGGATCGGTCATCGAGGATGGTTTC
TACCTCATATTCGCCAGCGAGCTGGTCTGGCTCCCAGCTATCTTCAGGCAACAACTCCTCGTCGAAGTCCAGTCTC