Description :
From Genome Similarity Track
Location :
Scaffold_139:30033- 31892
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_139-fgenesh-gene-0.8Heat shock protein 70
Pytap_DAOMBR444maker-pag1_scaffold_139-snap-gene-0.15NAD-specific glutamate dehydrogenase

Sequence
1859 bases(100 bases per row)
GCCTCCCGGACCAGCGCCAGCTTCACTAGCGTACAGCTTCTGCATAATTGGGTTTGCCACTCCCTCCAGCTCCTTCATTTTGGCGTCGTATTCCTCTTTC
TCAGCTGCTTGATGCTGGTCCAGCCACTCAATCACGCCATTTACGGCAGAGTCGATCGTCTTCTTGTCGTCTTGGTCGAGCTTCATCACGAGTTTCTCGT
CTTGAACTGCTGAACGGAGCGAAAaTGCATAATTCTCCAAAGCATtCTTCGCCTCAACGCGCAGTTTGTTGCGCTCGTCTTGATCTTTGTACTTTTCGGC
CTCTTGCACCATGCGATCGATCTCTTCCTGCGACAGACGTCCTTTGTCGTTCGTAATTGTAATCTTATTCTCTTTGCCAGTCGATTTCTCAACAGCCGAC
ACGTTCAAAATTCCGTTTGCATCAATGTCGAACGTCACGTCGATCTGAGGGACACCACGGGGCATTGGTGGCAACCcGTCCAGACTGAACTTaCCcAAAA
GGTGATTGTCACGGGTCATTGTACGTTCACCTTCAAAAaCCTGAATCAAGACTCCGGGCTGGTTATCAGCATAGGTGGAGAATGTCTGCGACTTCTTCGT
TGGCACCGTAGTATTGCGCGCAATCAGCGTCGTCATGACCCCACCcGCAGTTTCCAAACCCAAAGAAAGAGGCGTCACGTCGAGCAACAGAAGATCTTGT
AGCTTGGAAGACTTGTCGCTGCCCGAAAGGATCGCCGCCTGCACTGTCGCGCCAAATGCCACCGCTTCATCCGGATTGATCGACTTGTACAGCTCTTTTC
CGTTGAAGTAGTCCGACAGCATCTGCTGGATCTTTGGAATACGCGTCGATCCGCCCACCAGCACAACCTCTTGCACCTGGCTCTTGCTTAGTTTGGAATC
GCGCAACACTCGTTCCACCGGCTCCATTGTCTTGCGGAAAAAGTCTCCACAAAGGTCTTCAAACCGGGCGCGTGTAATCGTCGAGTTGAAATCAATCCCT
TCGTACAGCGAATCAATTTCAATATACGCCTGAGCCGACGAGGAAAGCGTGCGTTTTGCTCGCTCACAGGCAGTGCGCAAGCGACGCAACGCGCGTTGGT
TGTTGGACATGTCTCGACGGTGCTTCCGCTTAAACTCACCCACAAAGTACTCGACCAGGCGGTTATCAAAGTCCTCCCCGCCCAAGTGAGTGTCGCCCGC
AGTAGCCTTGACTTCGAAAATGCCTTCTTCGATTGTCAACAGACTCACATCAAATGTGCCACCCCCGAGATCAAAGATCAGTACGTTGTGCTCGCCTCCT
TTTCGATCCAGTCCATAAGCAATAGCCGCCGCAGTCGGCTCATTGATAATGCGAAGCACATTCAGACCAGCAATGGCACCAGCGTCTTTCGTTGCCTGAC
GCTGGGAGTCGTTGAAATAGGCGGGAACCGTGATcACTGCATTCTTCACCTGTTTCCCGATGTATGCCTCCGCAATGTCCCGCATCTTTGTAAGCACCAT
CGACGAAATCTCCTCCGCGTAGAACCGTTTGCTTTCTCCCTTGAACTCGACGATGATCTGGGGCTTATCGTCCGGCCCAGCTACCACTTGGAAGGGCCAG
TGCTTCAGATCTGCCTGTACGACTGGGTCGCGGAACTTGCGGCCAATCAGCCGCTTGGCGTCGAACACCGTGTTGTGGGCATTCATCGCGACTTGGTTCT
TCGCCGCATCTCCAATGAGCCGCTCAGTGCCCGTGAAGGCGACGTACGAGGGGGTCGTGCGGTTGCCCTGGTCATTCGCGATGATCTCGACACGGTCGTT
TTGCCACACACCGACACACGAGTACGTCGTGCCGAGGTCGATGCCGACCGACTGGCCTG