Description :
From Genome Similarity Track
Location :
Scaffold_1264:3003- 4222
Transcript NameFunction/comments
Phyag_g10096hypothetical protein
Phyag_g10097hypothetical protein PHYSODRAFT_508758

Sequence
1219 bases(100 bases per row)
TGCCCTTGGTCTGCATCACATTACGAAGGAAATTGACTCTACGCTCTGTATTATCTTGTTGCAGTGCGTCGGAGGACGCATTGGCCTCGAAAAACTTGTC
TGCTCTACAACCGTCGGCTACGAACACCACCACACGCTTGGCTGGCGGGGAGTCCGTGTACGCCACGCTCTCGATGTGAGGCACCACGGGGGACGTGAAG
TAgatgtcgaagatgctgagCACGTACAGCGCGTGGAAGAACACGCCCAGCACGAGGAGGCGAGCCAAGCCGCCGCCCACCTTGGTCATGATGGGAAATG
TGCTCTTTGTTTCGCTTTTTGGCTCCAAGAGGAACTGGAAGATACACTTGCGAGTTGTATGCGAAAAGCGCTATTGTAAATGTAACTGCTCTGTAACTGT
TGGCTAGATAGGGCTGCGGAAACGGATAAAGAGCATGTACGATTATACATCGGTTACAAAGTTTAGTATCGGAGCTGAGTATGCCGCAGATGGGAGGCAG
CATCCgcgaggaggtggaggtggcgctgcacgagcacCGCTTCCTGGTGACGAAGCTGCTAGAGTCGCTCAATACGGCGTCTCTGTACGTGTTTCACTTA
GCTAGTCTCTTCCTTCATTCGCCTGGGGTTTAGCATGCTAATTCTAACGTAAAACCCTGCTCTAACTCAATGCTCTACAACTGTAAAGACCGCCGTCCAC
GATCACCGCCACGAGGCTGCGCACAGTTAACGAGACGTTCTCTAAAGTACTGGAGAAGGATCGAGATCTACTGGCTGCAGTGAAGAAATGTGCGTTGGGG
GACgcaggagacgacgacgatgattaAAGAAAGGTTAACCTTTATTTATTTCTGCACTGTAGTGGCAAGACATCAGGTGGCGCAGAAGGAATTGCTGCGG
GTGGAGGCTGAGatcgagaacaagaagcagaaagtgGTGCAATACGCAGCTCAGCTGCGTCGCTCCCAGGAGGATATCGCCAATGTGTTGAGGAAACATC
GCGTCGTACTGCAAAATGCCAAGCAAAAGTCCAAAGGTGGCTACATTTTGAGTGTGCTGGATGGGGGTTGTGTGTATTAACGTGTACTTTAATGCGGCTG
CAGTGGTGTTGGATCCTCGCGACATTGTTGCGTATGCGCATCGTATTGCTGGgacgacgtcggcgccgAAGGAGTGGCAGCCTGGCGTACGTTGGTTGGG
TTATATAGGTTATTTATTC