Description :
From Genome Similarity Track
Location :
Scaffold_170:3002- 4166
Transcript NameFunction/comments
Phypl_g4634translation initiation factor eIF-2B subunit epsilon, putative
Phypl_g4635hypothetical protein

Sequence
1164 bases(100 bases per row)
GTAGTCGAAGTCCTCGGCAAACTTCAGTAGCACCTCGGGCGAGCACACGTCGATGTAGCAGTCCAGCAGgtcgctgcgcagcgccagctgcgcgtggtcc
tcgaggaagagcgtggccaggcgcgtgctgcgctgctccgggtcgtcctcgtacagcacgagctgcgacgtggcggcgtccacgcccaccacgagctcgt
cgtccagcggccGGACGCTCGTGGCGAAGTTGgggcgcagctccttgaagATGCTCGTCATGATGCAGTTCGGGTCCGCCTTCTTGCGGCTCTTGTgctc
ggcgatggccgccTGCAGGTCCACgttggccaccacgtcgccgctcATGAGCACGAACGGGTTGCtctgcacgagctggcgccggtccagctcgcgcagc
gcgtcgcccgCCGTGAGGCAGCTCGGGCTGCTGACGCACGTGACGTCGAGGCGCGTGGCCACCTGcgactcgagctcgatgaaGCGCTCGACCTCCTCCG
TGTGGCCCGtgcagaagagcagcacttcctgcaCCCCCGAGGCggccaggaactcgagcgagTACTCGAGCATGGGGACGTTGGCcaggggcagcagcac
cttgggCAGGTCGCGCGTGATGGGGCGGAACGTCTCCGTGAACGAGTCGGCGAACAGCACGGCCTGCAGGGGCGCCTCGCGGCgcgtgtcgtcgctggcg
gaCGCGTtcggcgcggcgcggcggcggctcaTCGGGACTCGGAAGGTGATGGATTCACTaagtgagctgctggccaagcagggGAACCGGTATCCTGCGG
TGGAATACCGGTATGAAAACGGTTGCCTCTGCACGCCGATTGGCTGGAAAGGggcgacaacttcaacaacgGCAACTATAAGTAGTGTCCTTGTGTCTTG
ATGTCGCTGCGAGGGTCTGCGTCATGCTCGGCGTTCGACGTGTCCACCCGCAAggtgccgtcgctggcgctggtgcctCGCGGGCATCTGAATCATGCGA
CTCGAGCCacgaagaaggtggcgggcAGCATCCAGCACGCGACGAGGCGCCAACACcgcgaggacgaggtcgcGGATCGCTTCGTGGGGGACAAATCGCC
ACCCccgccgcttcttcgacgtcaGCAACTGGGCgacacgctggaggagacggcaGCAGGGGAG