Description :
From Genome Similarity Track
Location :
Scaffold_223:30009- 31045
Transcript NameFunction/comments
Phyke_g6811hypothetical protein PHYSODRAFT_503160

Sequence
1036 bases(100 bases per row)
TTTCCCCAGTAATAGCTAAATGAATCCTGAAGTTCCGCTTCTTCTAAGGAGACACCTAGGCCATGGATGAAAACACACGGGCGTGGTGTCGACTTACAGG
AGCACTTAGGTGTACTTAGCGAGAAGCTTAATCCGATAAAGCCTCTCGACTCGCTGTTTGGGATCGGCTCTCCTGTTAGCAAAGCCACCGTCGTCGACGT
CACAGAGCTACCGTTTACGACGATCTCGCACTCGCTTTTGGCATCAGCATCCATCTTCGGCGCCGAGATCTCCACGGATCTGTTAAGGTACTTGATCGCG
ACATCCAGATCGCTGCCGTAGATGTTAGCACCAGACGACCCTGAAGCGCACAGCGCATAGGTTCCTCCTCCGAACGAAATTTTGAAAAGGTTGCCAGGCG
AGCACTTGATTACACCATCGGGTGTCGATACATTAGATGCTACGGTGGCATCATTAAGCGCGGATACGATGTCGTTGAGCGGTGGTAGGGAATCTGCTTC
CAGGCATTGTACTGTCGACGAAGAGGTTTGATCTGTCTGGTCGGCCTCAGAACCACTCGAGTAGTAAGCAACACCGTCAACGAGTGTATACTTGTGGGAT
GTGGAGTCTTCCGTGAATTCTGCAAAACCATCGTAGCGCACATCGACACCATCCGAAGACACGACGGGATTCGCGAACATATCGAACTCCGACTCGCCAT
GAATTTTCATCGAGTTGCGCTTCAGCTTGAACTGGAATTGCAACGACGGCCATTCTTTCGAGCTGGCGAGGAGGTCGCCGTGGACGGTCGATTTGCCTGC
AGACGCTGTCGGTGTTGAGAACGCGACGAAGGCAAATGCCAACAATTGGGGAACCCATGACTTCATCTTCGCAGCCCCCTATACCGATTCCTCGAAGCTT
GGAGGCGAATTATACAATGAGGAGGGCCTTGATGGCAACCTCTTGCCGGTGTTTTCGCTGGTGCATGAGGTATCACACTAGGCCGACTCCGGCTTCTTGT
CTTAGCCGGTGCAATCGGTGATGGCGTCCCTCCTTG