Description :
From Genome Similarity Track
Location :
Scaffold_804:300- 5386
Transcript NameFunction/comments
Phyag_g8123conserved hypothetical protein
Phyag_g8124conserved hypothetical protein
Phyag_g8125hypothetical protein

Sequence
5086 bases(100 bases per row)
gctccgccgctTGATCATGCGCAGTCTTCGCCACACCTGCTTCTTCCGCCACCCAGCCACGCCTCCATGAGCATGATGGGACTGCGTCCGCTGGGCCCGA
GCATCGGAGCCCAGCACCCAGTCTtaggcgacggcggcggcatgtTCTCCATTCCAAGCTTCCCGTCGGACGTGCACCCAGACCCCGACATGATCGACGA
CAGCCCCGTGATCCTGCGGCCCGGGTCGTCCGTCGCGATGCTGCGAGGCCAGCACATGTCTGAAGACGCTAGCCATCCGTCCTGGTACGACGAGGAGGCA
GTGTCCGAGCGCCTCAGTTGCTGTGAGATCATCCGCATGGGCttcgactcgctgctgctactggctgcagctgcaggcgtcgTGCTGGCTGCTTATCTTC
CCGTGGACATTGAGCGCGGTGTGCGTCATGGAGGAGCTCTGCCTTATGTCTTCGCAGTGTTTGTGGCCGTTGCAGGCTACGAGTTCGCGTGGCTGGCGTA
TCGTGTGCGACTCAAGCTCTTCATGCccttcaagctgcacgagAAGCAGACGTCGAGGGAGATGTACAGACAGATCATCGCCTAtgcggtggacgaggac
acgTGCGCCGTCACGCCCCTAGCCGAAAAGTTGTTCTGTGGCAGTAAAGTGTTTGCAGCCCTTGTGACGTCGGCCTTGGCGACGGGAGCTGCAGTGGGGC
TCTGCTACGTGCCTGGAATGACTAAAATGCCCATGATTTACGTCGGAGTTAGCTCGTTCATGGGGTCGTTCTCGGCCGCATTGGCGCCGAATGTCCCGAC
GGCTCTGTGTATGATGGTCCGGTATGCCTACTTCTTCCTGTCGTCGCTGAATGTTATCCTACGTCGAGATGCGAACGCGACTGCTAGTGGCGATGGGAGT
GGTTCGGTCAACGACTACAGTGGTGAATTGGACACTCGACATGCTATGGACAAGTATctggcagtggtggtggagtcgtattcactgttgctgctgggtg
tGTGTCTGCTTCTGGTTATTCGCGCTGTGACGAGCAAAGACTCTGTGGAATCAGCGCTGATGATCGTACTGGACGTTGCTGGTTTGCTCTACCTcagctg
tgcagcagctgtgttggagctggtggcacAGTCCACGAGAGTCCGTGCAAGCGGTGCATTGGCTGGGTTCTTCGCCATTGTGTGGAGCTCTGAACTGGGA
GCGTTCCTCACTGCGCGCTTATTGAAGGCTGTGCACTTCCCATGGATGCACCCGCTGTCGAAGAACGTGTCGTCACAGCAGAACGTCGAGAAATTGATGG
GAGCGATCGGCTTCGCGGTCGGTGCCACATTTGTTGCTGAGAGTTTCGTGGAGTTCGACATGAACATTGAGTTCGTCGCTTTGGTGAGTGTCGGAGCTGC
CGTGTGTGCCCACATCGGCAAGCTTTTCCTGGTCagcctcaagaagatcgctaAGATCTCCAAAACAGGCTCCTATCTTCGTGTTGGCGGCGGTGTCCTA
GACCGTATCGATACGCTGCTCTTCATGGCTGTAGTGTTTGCTCCGTTCTTCCAGCGCGCTGTTTACAACCAGCCGCAATGGTAATCGCTTGGCAGAATGC
AATGCAAGCGAAGCACCAACCAAACCCGAAGAATATATTTAACGATGTCGTGTCTTCACTTCACTTGTTCAGTCATGCTACGCGTCGAAAAGTGTGCTGT
TTTACATGACAACGCAGCCCTTCTCGCCATCCTGCAGGTCTGCaccatcatcgtcgtcgtcgctttcagCTTTACCATCCTTTGCCTCATCGGCTTCCTC
GGTttcaccaccgtcgccgtTTGTTGCCTTCTCAGCCGCTACatgctgcttcttgatcaCTTTCCGCAACCTCTCCACGTCGTACATGGTGAGCACGGTG
CTGTTGCGAATTACGAGTTGGTCGTCAAACCCAAGCGTCTTGCAGCTGAGCTCCAGCTTTTGTGGCTCACTACTGGGGTCATCCAGTCCCAGCAGTTCAC
CCATCGTATTCTGCATGAACAGAGGCTGCTTGCCAACAAGCTCGATCTGCGCGTTCAGCGAACGTGTCAACCATGCCAGCTCGGTCACGTCGGGTATGCT
CGGGTCGCCCTTGCGGAACACCACAGCAGACGGGTACAAAGCTTCACTCTTGACTTTGGCAATCGGCAGCGAGTGTTTCTCGATAGCATCCAGGTCGTCA
AATGGCACAGAAGTATGTGGCCCATAGAGAATTGACATCTCCTTCGCACCCCACACGATTTTGTGCTCCCCAGCACCGCTAGTGGCGCCACTAGCAGGAG
TGCAACTAACCTTGTGGTCCTTCCAGTGACCACGCTGGCACTGTGCGTCGCAGTAGAACGTGCACTTGCAGCGCGTGCATCGTTTGAGTTCCTTACCCGG
GGCGGCGCGTTTGTCGCACTTGGCACATCGACGTAGCTCCGGGTTCTCCATGAGTGCAAGCTGCTCTCCAGGAGGCAGCACACGGCGTTCCAGATCCGCG
CGTGTGTAAAACAGCGCCATACCACGAATGTGGTCGCCACCCTCGCCGTTGGGTCCACTGCCGGTGTGCGTGCTGATGACAGACGAGAACACAGTGCCTC
GACCGACGTGGTGGCGAGCATCCAgtcgcagctcttcgtcccCTACGGCATCGACCTGAATCGCTTGGCGTTCAGCGAGGTGGTTCCACGGCTCCAACTT
GGCGTACTGCTCGCAAGCTGAGTAGAAATCGGATAGCACCTCAGGTGTCACCCCAGCGCCCGAGATCAATCCAGGACGCTCGCTCACTTCTGCCACAGAC
GCAAGGTCCTTCCGGATCAAGTGCTGCGACAACTCCCTGCAGCCAGAAGACGAATCGCATTGTTAGTCAACAGATCCCTATCGGCACAAACTCCTGACGA
CGTACTGAATGTAGGCGTCGATGCCGTCCGATTCCGACAGGTACGAGCACTCAATCCCCAATGCTGAGTAGCTCTTCCTCAACTGTCCTACAAAGTGCTT
GTCCGGGAAGACGATCTTGTCCGGGCGGTGCTGGGGAGTGTTCGTCGGCGGATCCAGCATCGCTTGCAGagtcagctccagcacctccttcggCGATGGA
TACACCTCAGGCGGGTCACAGATCTTCTTGGACACCACTTGCCCCAACGGGTACAAATTGTTCACCAGCACGCAGTACGGACGACAGGGCACAGCGTCGT
GTCCCTCGTCAGCACCGGCACTCGACGCCGACCACACTCGGAGCTGGCGAACCACAACCTGCCAaacctccagctgcttcttctccaacttccGGTAGCG
CTCCACCTGCTTGGGCGTCAGTAGCATCTCCGTGCTGATCACAATGTCCGCTGGTAGATAGATAGCGATAGAGTACAGTTAGGATGCAGCACGTTGTCTT
AGGTTTGTAAGAGCACGAACCATCGCCCTCCACGTCGAACTGCGTGGGCACACGAGGAACATCTTCActgtccgagtccgagtcgtcctAATTGCAGAGA
ATtagcaacaagaagccaaGAAAGGAGATAATTAGCTAGGAACCGCAATGGGAGAGGAATATTGGCCATAAATCCTCATCTACTGAGCGGTGAgaggcag
cagtggcatGGCCAAAACCGCGAGGAGATGGGGAGGACAGCGGGGGGGATATCCGCACCTGGAAGTTGTTCCacttctcgtacttcttggtCAAGAACTG
CTCGGGCGACGCCATACTGGAGCCTTGCTTTTGTCGAAGTTTGCAAGTAAATTATGGTTTGATTAGCACAAAGATTACATCGCAAATTAGGCAAAAAATT
AGGCAAAAATATTAAAACAACGGATAAACCCCCGCAATGCCTTCAATTCAAGAGCAATCTTTAGCAATAATGGACAACTTGGTCGAGactctgcaactgc
agcgcggcgagctgctggcggtgcaCGCGTCCACGAGCGACCGCGAGGCCGCGcagaagctcgtgcagcagatCAAGAGCGTGTCGGAGGagttggagct
cgtggctgctgctgcttctccctCTCCACAGGCGGCTACACTCTCTCCAGACTTCTACGCGAGCTATCTGCTCATCGTTTTACTGTCCAAGAACCTCAAC
GACGCTCGGTTCCTGTGGAAACGCATCGCGCATGAGGTTAAGCAGACGTCAGAGGAGCTACGTAACGTGTGGGAGGTCGGCAAGGCGCTGTGGCAGCGGT
GAGCGCTAGAAAACTTTGAAAAGCTTTGAAAGTTCTTGACCTTTATtctattttttttattattgTGGCAGGAACCTGGCTGCGGCGTATGCTGCGATGG
ACTACGACTGGTCTCCGGCTTTGCAAGGACTCGTTGAGGCGCTCAAGAGTGTGTGGCTTGCTGTAAATGCTGCTGATGGATACAGTTTTTGACCAGTTTT
GTGTCTTTTGTGCCCTACAGCTTCTACCCGCGAGGGCACAGCAGAACTGCTGAGTCTCGCGTATTCGACCATCTCTGTGAGTGAcgcggcgttggcgctg
ggctTCGTGCGCCATGAAGACGCACTGCAGTGTGAGTAGAGCTAAAGATGTTGTTTAGGCCCAGACTGTGAGCTGACGTTCGTGCGTTATCTTGTTTTga
ttttgctgttgcagacTGCTCGTCGCTGAATTgggaggtggcggtggcggaTCAGTTGATTTTTCCGAAGCCACTTGCCAACGTGCGACGCGGACCGTCG
ACGGTTGTGGATCTGGACCAACTCGACACTTTGTCCAAGACGGTGCTACATCTGGAGCAGAACAcggtgttgaagctgccgtgAGGTAGGTAGCAAACTG
TGTAATGAGGCGCGTCAATATAAGCCGCCGATCTTTCAGACACCCTTTCGGTgagtcgtcgtgctgctttAGATACGCTGCGgatggagaagcgcaagtc
AGGTCGTCGGAGGACTGCAGATCTCAAGGCCGCTAGCGATGCTGAGTCCACCGGCAGCACGCGCAgtagcaatagcagcaagagtaacaacagcagcagc
aggacgacgtggaggcagaagcagcgacagctcaGGGCAGAACGCATCAGCAGTCGCGACAATGCTGATGCAAGTAGTGTTCAACA