Description :
From Genome Similarity Track
Location :
Scaffold_220:30- 5099
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19893hypothetical protein
Phypa_INRA-310PPTG_19894hypothetical protein
Phypa_INRA-310PPTG_19895hypothetical protein

Sequence
5069 bases(100 bases per row)
AAAACCTACGCGCTTACAACACTTTCGTTGGAGTGCTACTTAAAGAGTAAGATCGTACTTGCGAGTAATGACTCGTTGGTGCATCTCAAGTAACAGTAGA
GCCTGAGACCGAGAGAAATAAAAACAAATTTTTCGGTTCACTACTTGAATAAAATAATAAAAAAGTAGTCCAAAAGCCTTCCTTTCACCTCGATTCACTC
TTTCAATTTTTAGCTATCCGCGTAAAAATAAAATTGACACCATCCTCTGCTCCTAACTACCAAAATGGCGAGTCATGGCAAGGTGGAGACTAGCCATCAA
CAACCGCCTCTCTTCGCTCGACTTCAGCACAGGATCGCCGCTGGATGGAAGCGCAGTCGCATTAGTCAGCGGAGTGAATACTCCGTGGAGCGTCTACTAG
CTTTTCGAGATTATCATCGGACTACCTCCGCCACCAGAGTCATTGTCGTTTGCGTTCTAGCGCCGATCCCAGCATTGCTAGTGGCTCTTGGGATTGATTG
CATCCCTCTAAGACCTCCATCCGAAGGATGGCGAGCCAATTATGCCGTTTGGATTCGATTGTGTGCCGCTATGTTTTTCGAAGCTCTTGGCGTGGTATGG
CAAGTGAGAGAAGTCATCATTTCAGGAACGATCTCAAATACTGGAGCTAGTATAATCGCACTAGGCACAGCCGTCAATTGTGTGCTTGTTACCATTGCAG
TAGCAGAAGCGTGGAAGTTCCCCATCCCGTTTGGTTACGTGCTGATGACGAACGTGTATGTGCTGATTTTCTGCACTTGGATGATTCTGGGCATTGGCCC
TCGCGTTCTAGCTAACTCAACAGTGCTACGCCAGCAAATTAAGGCCCAATTATTTATTATCGCCAATCAAGGGATTGTTGTCGTATGCTACCCCGTATTT
AGCGCTGTGTTCGATCGATTGTCGGCAACACAACAAGGTTTTTTCGTCTTCTTGATGCCGATGATAAAGTTTTTTACCAAGCAGAATATCGCAAATGCAG
CCAAAACTTCGCACGAGTACGTCGGACCAATCGTTGTTTTCTCCGTGGATCTCTTCAACGTGTACTACGTTGCAATCTGCATGCAATCGGCGAAATCGCT
AGTTACTACGTTGGTTATCATATCAACGGACACCTTTTTCATTGTGATCGCTCTTCGCGCCATTTACAAACGAGTTAATAGTCTAGACGCAAATGACACA
ATATGTGAGGGCAATTATCTTCAAGCTCTACTCGGACTAGTGAGAAAAGTGTTCCAGGAAACGACTTTTTCACGCGATTCAACGCAGCGAATTCGACTTC
TGGCGCCATTTCCACTTCGAATCTCTGACGAAAGCAGCGCATGCATGAAAACACTTTCGAAAACTGCGAGATTGCCTATCAATTCCCGAATTTCGACTAA
ATCCTCCGGGCGTCAACCCAGTAAAAACCAATCCATGACAACCATAGCAGTCTTACCGAAGAAGACTCAGGTTGCCCCAGATATCCCACATAACACACAC
GACCCAAAGCTAAGAGTAACACCGTCCTCTGTTGCCAAACTCAACAATATTCTGGCTTCTAAAGCCAGAGAGGAGATTGTTCATGATGCGCTGCAGTCAC
TTTTCCACTCGGAATATATACTACTGGCTGAATATATTGAGCTGATGGTCCCCATGCTGTATTCGCTCTACCTGGTGGTGCTGTTCCACCTCCCAGTAGC
GGCCTATTATCCGCATACGGCATCGATGACGGTGTCCGATCTACAAGGGGCTGTGATGAGTATTCTGGCTTATGCGGTGATTGAGTTGGTATCATTTACG
GTACTCCTGGTTCTATTGTGGCGGAAGTTTGGGTTTTCGCCGTTGTACCAGTTGGCGTTCGTGTTGGAGACGCAGGGTCCAGCCCTGCAGGGATACCTCT
TTGTATGGACTATCACCATTTTGCATTTAAAACTGGCGCATTATGGTACGTGGGAGAATGGGTTTTTGCCTCTGGAATTGTACTGATCAAGTTGATATGG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGTCGCATTGGTGTACGTCTGTCCCCGAACGGCGTCTTCGGCGGCATGGGTAGCAAGGATAACAACGAGATGTTCA
CGTATGCCTTCGAGCGTCTATCGGAACACGGCCTCGCCTACTTGGCTATGCTGGACGGCTTCGGCTTCGGCTACTCGACGGAGAGCCGCACGTTGACCGT
GTTCGACGCCAAGAAGGCGTTCAAGGGACCTGTCATGGCCAACAACAGCTACACGCGCGACACGGCAGAAGGTGTAATTCGCAGCGGAGCGGCCGATTTT
GTGGGCTTCGCTCGTCTGTACATGTCGAACCCGGACCTGGCCGAGCGTTTCCAGAACGACTGGCCATTGAACCCGGTGCCTGACTACAAGTACTTCTGGG
ATGCTGCTATGGGCGACAAGGGCTACAACACGTTCGAGCACTACAAGCCCACGGTGGAGGAGCAGCCATAGAAACTTACTCAGTTGAACCGTGCCATTAA
AAGACCAGAAACAATACATACATACTTTACGTACTCAATGGCCTTGAACGGGGGAGGGGGGAGGGTTGTAGATGCCCTGGGGCGTGTCGACACCGTTTGT
CACCGCTTGCCACCGTTTTACACCGCTTCGGTCCCAACTAAACGTGTCGATACCCCGTGCAAATCGCAAAAATACCGCAATACAATAAAGAAGTGACATA
AAGAGCAACCAATTGCTACATAATAACTACAGTGCCTTCGGTAATTAGTCTGTGTGAATAAATAGTCACAGTTCGTAATTAGTCACACTGTTCGAAGGTG
AGACTATGTCGTGTTCAAAATTAGTATAATTAGTATCACCTTATTTCGGGTATTCGAATTGACGCACTGGAAAAGACTGGCCCGGTTTACAATCCTGGCA
GTCCGTAGAGATTGAATCAGAGTCGTTAGCACTCGTTAAGGTTAGGGCTCGCCATGCTATCTCCTTTTATTGTGTTCTCTCTGGAAATTAATACTGGAAG
AACACGGTACTTGTGATTCTATTATCTTATATCAAAATAACTGGTTGCGGCAGGTATTTACTGTGTATTAGACTACCAGATACAAACAATAGGATAATAC
CTTATCGTTCCCACTAATACCAATCTCACTTTTTCATTTTCGTTTCAAACCTTATTCCACGTGTCTTTCTTCAAGTGCAAGAGTGTCTCTCAACAGGCTA
TGAGCCCAACCAAGCCTCAAGTGAGGACTTCCCTCGACTTTCCGGCGCAAGGAATTACGACGTGTGGAAGACCCGAGTGACGGCATCGCTTGATGGTAAG
CACCTACTCGGTTTCGTCACGAAGAAGGACTACGACGGGTTGAGCAGCGACGAAGATGACGAAGACTCGTCCGACAGCGAGAGGTCCGATGCCGAGGTTG
CATCCAAGACCTCGCCTCCAGTCGAATACAACTTGAGTCCGTCAACTACGAGCCAACCTCTGAAGAAGAAGAAGAATCCGGCAGCGAAGAAGATGCCAAG
ATCAGCAAGGAGCCCAAGGCACTGTCGCCAATCCGCTCGTTCTCGCAGCGCAAGGTGCAGCGCCGAGCCAAGAAGGAGAAGCGCGTGCCACTGTCGTCAC
GCCGTCTTCGTCGCATGGAGGCACAGACCAAGTCGTTCCTGATGAAGACGATGGACGACACGCACATTCGTCTGGTCAAGAACCCCACCACGGCCTATGA
CATTTTCCAAGCCATCTGCAAGAAGTACGAGGGTGCCGCATTCCGTGGCGACCCGTACTACATCCTGCACTTCCTCCTGGAGACCAAGTACGAGGAAAAC
AGTGATGTGAACGAGTTCTTCCTCGTTCGAGAAGACGCGATGAGAGCCGCGTCCAAGGCGACCGAATCG