Description :
From Genome Similarity Track
Location :
Scaffold_1880:30- 3560
Sequence
3530 bases(100 bases per row)
GGTATGGGAAGTTTTCTTAAACAGAGAAAGTGTTTCAGACAAGTCTATGTAGGAGTCAACATCAACAATGAAGAAGCAATCCTAATCCTTGATAGTGGTG
CCGAGGTGTCTATACTGAATACCGCCTTTGCTCGTATGGTTGGGTCCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGTTGTGTA
CCGTACGAACGGGAGAACGCGGATCAAGATCACGTTGGCAGGTTGTTTGATATACTGGTTCGATATTTGGGTTGGAGATCTCGCTGGTCAAGACGCCATC
CTCGGGATGGATTTCATGGTACCAGCCGGGGTAAGGTTGGATCTGGCGGTGGGACACTTTGTTTCCCCGACGAGGTGCTGATCCAGCTCAGTGGACGGCG
ACCGTTGCACGGGGCGAAGATGAGGATCATAAGGGCGGATAAAACCACCTGGATCGAGCCCGGGGAAACTTGGGAGCTACCAGACCGGTTAAAGTGGGCG
GAACATGAAAGACGGTGGGTCACCCGGGGCGAAAAATGGGTACCTACCGTAATCCAAGGACCAAGTCGATCGCAATACCTCCAGGTCACGAACGTCAGCG
ACAAGAGATTATTACTGGACCATTATGAGGAGATCGGGCGATGGTTGGCGAAGGACGGTATCCCTAGACGACCTGGATATGTGTCAGTGGGATCCCGCCG
CTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCTCTCGCAGAGGTGGAGCTCCCAGCGGAGCCAACTGGCCCTTTGGTGGAT
CGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTTGAGATCCAAGCAATGGAAGTTGGGTCCAGGACGGGGGACGATCCCCAGA
GTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAGGATTGCAGAGTGCTAAAGCCGAGCAGCCGGATCCCGCTGATCCACAAGTGGATCCAAGCTCTCCA
TTGGAAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCAAACCCGAACTGTCGGGCTTAAACTCGTTAGAGGATCAAGTCGATCCAACTGGTGG
TTTCCCTGATACCAGGGTACCTGAACCCCCGAAGATAGAAGGACTGCCAGGCGAGAGAGGGCCGCGGTGTTTGGATCCAATGGTGGATCCTACGAAGACG
GAAGATGAGCAAGTCTGTTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGTGGTGATCCCGGAGGTACCACTGACCACAGAAG
AAGTCACAATTGATGATATCCAAGTGGATCCAGGGGCGAACGAACCCACTGAAGTGGATCGTCTGCGTCAGAAGATCTGGGAAAGCCGACATCTGCTGAT
CGGTAAGGGTAATGCGTTACCGCCCGCCGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCA
CTTCAGTTCCGAGAAAAACTGTCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCGACGTCCCCGTGGGCATCCCCAGTGGTAATCA
TCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCCCTAATCAACGA
GCTGTTGGAAGATTTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCC
GCATTCATCACACCGTCTGGACTGTTCGAGTGGAACCGGATGCCATTTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTAATCGATAACGCTCTCT
ATGGATTCACCCGAATACCGGAACCCAAAAGGGGTGGATCCGGGGAAGATCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCAGGGGATCCTGGTAC
CCCGTCCGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAGAGAGTGACGTCCTTACTGGAGGCG
TGTACTAAGTGGAATCTCTCTATTAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGAGTACTTGGGCCATCGAGTTTCCAAGGAGGGATTGGAGG
CGAATCCTAAGGACCTGTCTTCATTAGCCGATTTGTCCTTCCCACAGTCGTTACGGGCGATGCAATCTTTCTTGGGCAGTTTGAAGTACTACAGTCGGTT
CATCGAGGATTACGCCCTGTTTGCCGCGGTGTTGTATGAATTAAGAGAGGTAGATTTTGCCGCGATGACCACTCCAGCTGTCCAGATGAAAATCCAACAA
GCTCTGGCCCAGGAGATGCCGGATCCACGAAGGGATCCAAGTGGTAGGACGCCAGAAGAGGACCTGAAAAATGAGCTGGATCCACCCCGGGACCAACAGA
GAGAGGATCCAGGCTGGATAGAGACGACGGATCAGAACATGGAACAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCGTTCGTGGAACTGAGGAACAG
AATCGCGACCACGCCTATCCTCCGTCATTTCGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTACAT
GAATATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCC
TGCGCGTGTTGGATCTGAATTACAACCTGCTAGTGGGAAGATCCATCCGGATCCTGACTCGACACTCTACGTTAGCCTGGCTGTTCAAGTCAGCCGGGTT
ACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGAACGCTGGAGATTGTGAAATGTTCGAAAGAGGAAGACGAGATCCTGGGAGTCTTGGCC
GCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAGGATCGCTCCTAAGAAAGAGCCCAAACGCCAGATCCAGATCCCGATCCCGACGGTAC
AGGTGGATGAGGATCTGTACGTCCTCAGTTTCGATGGATCCGCTCGTGTACGACGCGGAGGAGAAGCATACAGCGCAATACTGTGGAGACTGCCCGGATG
GAAAGTTGTACGGGCCAGATCCACTTACGCGGAAGGCCTCACCGTCAATGAAGCGGAGTATAACGGGCTCCTTCTGGGTTTGGATTTACTAAAGGGACAA
GATCCAAAACGGCTGGTGATTTGTGGGGATTCCAATTTGGTAATCAGACAGGTGCGAGGTGAAATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGC
AGAAAGTGATGATCCACCTGCGTGGTTGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCGGATAGCTTGGCCAGTGCCGCTTT
ACGGAATCAATGTGGTGTTGAAGTGGAGAG