Description :
From Genome Similarity Track
Location :
Scaffold_1890:30- 3547
Sequence
3517 bases(100 bases per row)
GGTGCGTTCTTCAATACAAAACGGCATCCGGTGAAACTCAAAACAGTCCAAGCGGTGTAATGAATGTGGATATTGCGCGAGCTCGATCCGTCATAGTAAC
CACCCAGAAACCACTGGCCATGTCTAGAGAGCAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTGATTAGAGGCATCGGATACACCATCAAT
CGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTTTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTCG
AGAAACTGATGATCTTAGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGCTTTTCCCGGAACTGAGGTGCCACCTTCCGCACCCTCTGAGCGATCGGTTT
CGCGTCACCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGA
CGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCCGGATCCACTTGGATATCATCAATCGTGACTTCTTCTGTGGTCAGTGGTACCTCCGGGATCACCG
CCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAACAGACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACA
CCGCGGCCCTTTCTCGCCTGGCAGTCCTTCTATCTTCGAGGGTTCAGGTACCCTGGTATCAGGGAAACCACCAGTTGGATCCTGTTGGTCCTCTAACGAG
TTTAAGCCCGACAGTTCGGGTTTGACTAGTGCTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGAGAGCTTGGATCCACTTGTGGATCAGCGG
GATCCGGCTGCTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCTCCCGTCCTGGATCCAAC
TTCCATTGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTTGCGGAGTTGGATATGAAGGCCGATCCACCAAGGAGCCAGTTGGCTCCGCTGGG
AGCTCCACCTCTGCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGTGATCCCACTGACGCATATCCAGGTC
GTCTAGGGATACCGTCCTTCGCCAACCATCGCCCGATCTCCTCATAATGGTCCAGTAATAATCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGA
TCGACCTGGTCCTTGGATTACGGTAGGTACCCATTTCTCGCCCCGGGTGACCCACAGTCTTTCATGTTCCACCAACTTTAACCGGTCTGGCAGCTCCCAA
GTTTCCCCGGGCTCGATCCAGGTGGTCTTATCCGCCATTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGCCCGCTGAGCTGGATCCGCATCTCGT
CAGGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCCGGCACCATGAAATCCATTCCAAGGATGGCGTCTTGACCAGCGAGATCCCCGAC
CCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTAATTCGCGTTCTCCCGTTTGTACGGTATACGCCTTCACCAATCCCAACACAATCT
TGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGAAGTAGGATTGCTTTTT
CATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGA
TCCAACATCCTCAGATCCACAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGG
CGTTTCTCCCAGTAACCACGTGCCTCTCCTCTTTGTAGATCCAGGGTTGAAGAGACTTTGGATCTGGAAACTCGTCCACTTGGCGCAAACTAGAGACCCT
GGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGTTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAG
TACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCTGCCACTTCCGGCAACATCCCTCGGTGCTTGGCTGG
ATCAAACCACTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCC
CCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTATGCTTCCGGGATCCGCACTGCGAACACCTGACTTGTG
CTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTT
GGATGCAGTGAGACAGACCCGACGGTAATTTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGCCTTGGTGGACA
CGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGACCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCA
GTACTTCTTCAAGCTCGTCTGCGTCGGGAAGTCGTAGCAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAATGATCCACGTGTTC
CCGCAGTACCTTGGATCCCCCATCCTTGATCCTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTTCAACGGGGATTCATCCGATCTG
CGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCTAATCCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTTGAT
CTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCG
ACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGACCTCCTTCAAGTCCGATATAGCTGAGATCCGTACTCTCTGGAT
CATGGACGATCCACCTGCCCCGGCTGTGGCCGTTGCTACCACGGCTGCCGAAGTGGATGGGCCATCCAGATCGTCTGGGTCGAACTCATCATGGGAGTTG
TCCCCCTCTACTGACTCCATCTCCACGTCCCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATGCCCTGTTCGGCCAGGAAGC
GATTCATCGCAGCTTCA