Description :
From Genome Similarity Track
Location :
Scaffold_1540:30- 3269
Sequence
3239 bases(100 bases per row)
TGAGCCAGCGCGCGCTCATAGTTCGTCACAGCGTCGCGAACATCTTCGAGGAGTCGAGCCCGCGGCTCCCACGTGTCCGCGTCCGGCGGATACCCGAGCC
AGCGCACGCGGTATTGACGATCGCGGGGGACGCCGCGACCCGAGGGACGGCTTCTTCCGCTCCGATTCTCCGGATCGGCGTGGTCGACAATACGATCCAG
CACCCAACGCTCGTTTCCTGCCGAGTCGAAGAGCGGGGGAGGACCATCGCGAACGAAGCGAGGGAGCGCCGCATTCTCGGCGCCACGAGCCGGGTTTGCA
AGATGAGTTTGGGGTGCTTCGGGCAGAGGTGCGGCGCCTGACGCGTCGCCTCGAGTTTGCGGACCAAGATGCGGAGAACGCGGTCTCGACTGCAAATGAG
ACCGAGGCAAACTTGGAGACGCTGGCGAACCTTCTGCACGCGACTCAGCGCCTCTTGGACTCGCTTAAGCAGTCTCACCGGGCATTGATGGAGCAGCGCC
GACGTGAGCGCCAAGGTCTACCGCCGGTGTCGCTGCCGAGGAAGAAGCAACGGGGGCCGTAGTGCGGACCCTGGAGGTTGGAACCGAGTTATCGGCGTCC
AAGTTCATATCCGTCGCATAGTACCTCTTGAGCCTTGACACATTGAATGTAGAATGGAGTCGCATTGCCTTGGTGATATCGAGCGTGTAGGCGTCGCCTC
TCTTGAACGACACCGTGAATGGTCCAATATAGCGGGGCAGCAGTATGTCAGCCCCAAGATTCGTCACAGAACTGGGTGCGATGCCATCGCTCGAGAGCAG
AACACGCTCGCCCACTTCGAATGTCGTAGTGTTTCCCCGGTTGTGTCGGTCTGCTTGTTTCTTCTGCTTGTCCACGGAGCGCGCGATCGCGTCCCTCACA
AAGCGGATGATCGTCTGGCGTCGCAACACAAAGTCAGTCGCCTTGTCGGAGCCGTGCGTCGGCTTCTCGTTGCGCGCGAAGTTCCCGACGGGCGAGTTGC
GCGCGCCGTGAGCAGTATCCTCGCGAGTATGACGGCGTCTCGGACTACCAAGAGATACGGGTGCGGCAGGTGGCTCTCGGATCAACTTACGAGCGGCCCA
TTGAGCAATTAACGACATCCGCGTGATAGGTGCCGTCGTATTCGGTGCCCGAGAGTGCGCTTGAACTGGGGCGAACTCTTCTTCAGCCGGAGGCAGCGTC
GCTGGTTCTGGGACGATGGTGACAGCTGCAAGTGGTGCATCGGTGATAGCGCATCTATCTGGAGTCGCGATCAGCGAGTCCCCTCCCCCACCAAGAGTGG
AGTGACCTGTTTCGCTCCCTAATAGGGCCGGAACACAAGGATGTCGTGCCAACACGACGAAGAAGGGTGAAAGGCCGGTCGAGGAATGAACTGCATTGTT
GATCGCGAACTCGGCCATCGGAAGAAAGTCGCTCCAAGACGACGTCGACGTCCATACTGATGGATGACCACGTGTCAGGAGGAACCAGAAGTGGCTTCAA
TGGCGCTCGGAGTGCGGGTGCCGACTTCACGCGTTGACATGTCTCGCAGGTGCGGACCCACTTCCGCACCCAACGGTACTGGTGAGGCCAATAGAAGTCA
CGTGATACCGCGAGGAAGGTCTTCTCACGTCCCAAGTGACCGCCCACGGCGGCATCATGATACTCGTGGAGAATACGCGAACACAAGTCATCGTCATTGG
GTACCACGGCGCGAGATGAATCATCTGGCGCCACATTATACGTCAGAATCCGGTCGCGTATGCCGTATCGGTGCCGTGCCGATTGCAAAGGCGTCGGCAC
CTTCTTCAAATTTGCCGGTGTCGGGTCAAGGAGGTACCGCAAGAGCGGGCCGTACCAGGCGTCGCGCTCCAACGACACAGCAAGCGATTTCCACAAATCA
GTCACGGCAGACACAGCAGTGGCTGCAACGCTCTCGGTGATACACGCGGCACATGATTCATCTTCGTCTTCTTCGGGAGCGGGTGCGCCGCCCCTAGCGT
CATACTCTGGACGTCGCGACAGCGCATCCGCCAAGACGTTCGACTTGTCGGGCTTGTAGTGAACCACGAAGTTGTAGTCAGGGAAGAATGACAACCAACG
GGCCATCCGCTGCGAGAGGTGCGGAGTCTTCATGGCCGTACGCAACGAAGCATGATCGGTGTGCACGGCGAAGCTGGTTTCACCAAGGAGGTAGACGCGG
AATTTTATCAAGGCGTATCGCATGGCGAGCAATTCCTTGTCGTGGACCGGGTAGTTCCGCTCCGCCTGCTTCAACTGACGCGACTAGTAACTGATGACAC
GCTCGCGTCCATTGTTGTCAAACTGCATGAGTGCGCAGCCGATCGCAAAGTTGCTCGCGTCGCAGACGACATGGAATGGCTTATCCGTATCTGGGAGTGC
CAATACTGGGGCTTCTGCAAGACTTTTCTTCACGTTTTCAAACGCGGACTGGTGCTCAGGGAGCCAGTCCCATTCAGCGTCTTTCTTCAGGAGCTGCGTG
AGAGGACGGACCAGCTCCGCGTAGTTGCGCGTGTACTTGTGAAGATAGTTCGCGAGACCAAGCCACTGCCGGAGATCTTTTGGGTTCTTTGGAGTCGGTT
ACTGTCAAATCGACTCCACCTTCTCCGGATCAGCGCGAACTCCGTCGCGACCCATGTAACAGCCGAGGACTTGGATCTCTGGAGCGCAGAAGACACACTT
CTTGAGGTTCGCGTAGAGACTGTTGGCCCGAAGTGCCTGGAAGACCTGCCGAAGGTGCCCGAGATGGGCTTCCACTTCTNNNNNNNNNNCTTCCCATCCA
TCGACCGACTGTGAATGAAGACATCGTTGAAGTAGCTCGGGGCGAAATCACGAAGGGGTCGCAGCACGTGCGATACCATCCGATTGAGCGTCGCTGGAGC
GTTCTTCAGGCCTTGAGGCATCACGAGCTATTCCCACAGCATCCCACTCGGCGTGCTGACAGCGGTGAGAGGCACATCGCTCTCTCTCATTAGGATCTGA
TAGAAGCCATCCTTCAGATCCAAGCTGCTGAAGATGGTGCTCCGCGTCATGGAGTCGAGCACCATATCTTTACGAGGGATCGGCGTCTGTGCGGGCACGG
TCGCGTCGTTCAGCTTGTTGTAGGCGTGGACGATGCGCCACCCTCCGGTCGCCTTCTTCACGCAGAATGTCGGGCTGCAGTGTGGCGACGAGCTCTCGCG
GACGTGGCCAGCTCGGCGGCGTTTTTCGAAGAAGTCGTC