Description :
From Genome Similarity Track
Location :
Scaffold_1073:30- 2716
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1073-fgenesh-gene-0.03'5'-cyclic nucleotide phosphodiesterase

Sequence
2686 bases(100 bases per row)
GGGCATGAAACTCGTTGCAAGCCAAACTGATAGGGGTTCGGTTCAATTTTTAGGGATAGGTTTGAGGAAGTGTAACTCGTATTACCTGAGTTTGGCTCGA
TATTCGTTTCGTGGTGCTTAACTGGTGGGTCAATTAATTGGAGATTGAATTGCGTGATTCCCTTGAAAGAGTGCCCTGTGTTGTTCGTTGAGAGCTGTTG
CGTATTTATATATATATATTCAATATTAATGTGCGAGTCTAGTACAGCAGCGGTATTTCGACGGTGCTCAAAAGAAATGGCTTGACAACCGGTTTTGCGC
CAGTTGTGGCACATTTAGTTTCCTTCTTTCTTTCGCGTCGTTTCATGATAAGCGTACCCATTTATGTACCCATGGTGGACATCTGCATCTACATCCAGGA
GCCACCTCAAAGTCACCAAAGCGATAAAAGATGGAGCCTCCGAGCGTGTTCGTGCCGCTCGCAGAGCTCAACGCGGTGCTGCATGGACTGCGCACGCGCG
ACAACGAGAAGCGCGCGCTGCTCGAGAAGATCGACGAGCAGCAGAAGCGCGTACTGCTGCTCAAGCAAAAGACGCTCCACGTGGACCACAAGCTCGCGCA
GTACAAGGCCGACCATCGGCAGAGCATGCTCTCGCCGCCGCATTCGACTGTACGCTTCCAGGAGCCCGGAACTTCAAGCCCCACGCGGTTCCCGCCGTCG
TTCTCCAGCGCATCGCCACACCGCGCGTCACCGTCCGTCTCGTCTTCGAAAAGCCCGACGAACGCGTCCACCGCGACCGCGTCGCTCGCTGCCTCAAACG
CTGCAAAGCTGGCAGCCATACCACCCGCTGAGCTTGCAGCGACGTCGACGACATCATCGCCGACTCATTTTATCTCGGCTGGCAACAACAGCAGCTCACA
CGACACAGGGCTGCTGGTGCCAACCGCGCGGATGGGATCCCTCATGATCATGAAGGAGCGCGTGAACCAGCTCGAGGACGTGGTCGCGTCAGTCAAAGAG
ATCTCGGCGCAGGGCGATTTCGCGGACGTGGTGTCGCGCACGTTGGGTGCCGCGCAGAAGCTCGTGCGCGCAGACAAGTATACACTCGGACTGCTCAACG
AGCGGCGCAACATCGTCGAGATCTTCTCTGTTACGCCTCAGAGTGCAAGCACATCCACTCAATTCAACAAGCAACACCCTAACCAACCTGCGCATGCGAA
CAGCGGCGGCGGCAAGAAGCACGCGGTGGCGTTCACAAGCGAAGGGTTTGTCGCAGCGGATAGCGCGACAACGTTCGCGCGCGTGATCATGACGGGCAAG
CCGCTGGACATCGAGGACTTCTACACACACGAGAACTACGACCAACAGATCAAGTCAAGCGGTATCGTCCCGCACGCGCTCTTCTGTCTGCCGATCCGCA
ATGCGCACCACGCAGTCGTCGGGGTCTTCCAGGTCGTCTCCATGGTCACTACTACCAGTACCAACACCAGCAATGGCAATACCAGCAGCTCCAACAATTC
AAATACACATAACAATAACAACTCCACAGTCGTACTCTTGCCGTCTCCCCACCTCTCATCAACGACGCCACGATCGTTCACCGAGGCCGACAAGCGCAGC
CTCGAGTTTCTTTCCGTGGTCGCAGGCTCAGCTATCTGGAACCTGATTCTCGTGCGCGAGCGCCAGACCGCGCAGAACCGCATCGAAGGGCTCTTGAAGC
TGCACCGCAATATCTCCATGGAAGCCGTCTCCTCTGCAGTTTTGGACCAGGTACTATCGGTGTGTCACGAATTACTTGGCACCGAGCGCATCGGGCTGTT
CATGAAGACCGATGGCGAGGACGAGCTCTACATCGCGTGCGCGGCCGAGATTGTGCGCGGCGAGTACGTGCCGAGCACGAAAGGCATCGTCGGCTACGTG
GCACGCACGGGTGAGACTGTGATCACGAACGATGCGTACTCGCATCCGCTGTTCGACTCGACTTTGGACCAGAAGACGGGCTTTGTCACCAAGCGCATCC
TCTGCCTGCCTGTGCGCAGCCCTGAGGGCACCATCCTGGCCGTGCTCTCGGCCGTCAACAAGGTCGACAGCACAGACTTCACGAGCGAAGACGCGATCTT
CCTTAACTACGCGGCCGACGCCGTGGGAATCTCCCTGCACAAGTCGAGTCTCCACCACGAAGTGAAGACGTCGCAGAAGCTCATTGAAGCGCGCTTGCGA
CTGACCACGTTTGTCTCCGAGAGCTCCAACATTGAAGAGTTTGTGGATTTGGTCATGGAGATTGGCAAGGACATTATGGAGTGCGACCGCTTCGGGTTTC
TGCTCATCGACCATTTCAAGAAAGAGCTCTGGATCACGCCACGCGTTGGAGGAGGTGAGAGCATTCGCACGCCCATGAACCGCGGCATCTCGGGGCTTGT
GGCCACCACGGGCCAAACCGTGTGCACCCGCGATGCGTACAAGCACGAGCTCTTCGACCCGAGTGTGGACGTCAAGACCGGTTACCGTACGACGAGCGTG
CTCTGCACGCCGATCTTCGAGGACCACTCGATCTCGAACCCCAAATGTGTGGCCGTCGCGATGTGCATCAACAAGAAAGAGGGCTCGCACGTCGTCGCGT
TTACGAAGACCGACCGCGACGTCATGGACAAGTACTCGCGCGAAGTGCAGTTCGCACTCGGTCGACTCTCGCTCGACATCTCGTAC