Description :
From Genome Similarity Track
Location :
scaffold_2041:30- 1950
Transcript NameFunction/comments
Pl_100164hypothetical protein PHYSODRAFT_410384
Pl_100165hypothetical protein PHYSODRAFT_481170
Pl_100166NA

Sequence
1920 bases(100 bases per row)
GCTCTACCGAGCCATTCACCCACGGACTCTTTGCTACCACAAATTGCTGTTGACACTTTAGTCGTTTGCAAAACTCAGCCACAACTTGGTTTTTAAAGTG
CAAACCATTATCACTAACCCATATTTGTGGTACACCGAAACGACTGTGCCACCCAAGTAGTGCTTCCACTGCTACCTCACTAGTTGGGGTATCGCAAGGT
ACTAATTCGCAAAAATGTGTGAAATTATCTTTGAGTACTAGCAGATATTTGCAAGCATCAAATCCTTCACCCAAATGTAGAAAATCCCAATGTAACGCTT
CATTGCGAATGTCAGATCTAAATAGTGCACCCCATGGCCTCGGAGCTATCCTGCCTCCTTTTATGTGCTGACATAACAAGCAGGCGCGCAGAAACCGACA
CACAAGGTTTGTCAATCCATCAATCAAAAATAAACGACGCGTGTGGTTCAAAACCACTGCTTCACCACGATGCCCTTGAGCCCCGCAATGGGCAATTACT
AGGAGACGCTGAATGAGCGTTTTGGCCACAGTAGGAATCCATAGTGTGCTCCCGACTCGGATCATCCCAGGTTCATCGCGGTCTCCTGTTGCCGGAGCTG
ATTTTATACTGCCGCAATTTCAGTCAATGTTGGCCATATAAACCCCTTTTGGTCAAGTGGTCGCAATACCGATTGACGAGTGGTTCTAACTTGCGAACGT
GTAACACGCTTGAAACTAGGGGCCGTAATCGTAGTTAGAGCAACAGGAGGACAACCACCCCACCTACTGATCATGCCCGCCCACAGGTTGTTAGCACCTT
CGATGTGAACAATCGTGTACCGGAATTCCATAAGTTTACAGCCCAACGAAGCAATTTTCCCCTAATATGCTTTTTCACCTCTTGTCCTGGTGCAAATACG
TGAATAAGGTTTCGTTGATCACAATACACTTTGAAACCACCGGGCCTCAGTAGTAGATAATCCAGATCCTCACAGGACAAAATGATAGGAAAAGCTTCCT
TTTCAATTATGCTCCAGTGTAGTTGAGCCCCACTAAACGATCCATCTTTGTAAATCAAGAGTTGGGGAGCCTGCCCCATGGTAGGGACGCCCTGCTTCCA
TTCAGCAACTTGTGTGACGATGGATGCCCATCCTTAGTCACTGGCATCTACGAACAAGCAGTAGGTAGCATCCTCGCGTGGGTGTATCATCATTGCTGCA
TGTTGTAAAAGGTTTTTATTTGTTCAAAGCTGTGTACTGCTTCAGGCTCAAAAGTAATGGACACTCCACAAGCAACTCGCTTCGTTTTCCGCTTTCCTGC
AAGTGCTTTGTCCAGTAGTAACTGGAGAGGGCGGTTGGTCCGTGCATAGTCAATGAGACTGTCACGCATCCAGTTAGTTGTGCAGATGAATTGTTGTAAT
TGTCCAGCTGTGGTATGTATTGGCATCGATAACAGAGTATCAATTCGTTTGGGGTCATGGCTGACACCATGCTCATCGATCACTTTACCGCACCACGTGA
CTGACTTTTGATATAGGGAACTCTTCTTCAGACTCAACTTTAGTCCGTACGTATTCACTAAATCAAACAGTTTTTCCAAAGCAGTGAGATACTCAGGAAT
TGTGTCTGCAAAGAAGAGTAGATCATAAATCCATATGAGCAAGTGATTATACAGCAATTCTGTGAAACAATCTTCCATCGATACTTGAAAATGTAATGCA
GAGTCACAACTACCTTGCATCACACGCGTTGGTGTGAACATACCTTCGTCCGCCATGTACGAAAGCATCTCTTGACTATCCAAATCAACAGCCAGTTGCC
AAAAGCTGCGAATAAAATCGAAAAGACCATAGTGTTTCTTATCTCGCAACCGCTCCAGTTTGGTTTCCAAATTAGGCATGACACCTACAAGTGCCTCCGT
CATTTCATTCAGTGGTTTGT