Description :
From Genome Similarity Track
Location :
Scaffold_3083:30- 1892
Sequence
1862 bases(100 bases per row)
TCGGATAAGCTCCGCGAGATGCGATTGAGCTGGAATCCGGCATGTTGATGTCGACGTCATTTCTGTCCCCAGCTTGAACCTTGAATGCGCAGTTCGGCCA
CCTTGAAGTAGAAGCGCTGCAATTCCGCTTGAAGCTACAGCAAGCGCGATCTTCTTTTCCAGTCGCACAGTAGCCAATATCTTGCTGAGGAGGAACGACT
TCCCTGTCCCACCTGGCCCGTCCAAGAAGAAGAGCTTCTGTCGAGTGGAGCTATCGCTAACGGCGTCCATGACTTCATCAAATACCTTGCGTTGGTCTTC
GCTAAGGTCGGAAACGCCCCTTGTAGCTTGCCTCAACTCGCCTCGATCATACGACGTCTCGCTGTCGATGAGCCGATTGAGGTCTGTCGGCGCACCTTCG
AGGTGAATGAAGTCGACCAATTGCGGCAAGCTCGGAAAGTGAGAGAGTCGCTTGGAGTTGCTCTGAAGGTGAAGATCAACAGCCTTAAGTGTCTGGAAAA
TGACGATTGGAGCAGAACAGTCACGACCAGAATCGCGCTGGAAATCCTCTGACATCGCATGAAGTGGCTCTTTCCACAACCGCGCTGTGTCGGCAGGTTC
GCAGTACACCAAGATGACAGCGAAGAGAAGGCGAAGTTGAGACGGCATCCCCGTAGACGTTGCTTCACGCATGCAAGCATACCACTCGCTGTCGTCTTCG
AGATACTCAGACGCCTTGACTGCTTCCTTGTACGTGGCGAAGGTTGTTCCTTCCACCGTTCGGAGATCTTCAAACGACTTCGGGCCACGACGGTAGCACA
ACAGCATGCGCAGAAAGTAACGCTCGCTATCCATCGGGCTGCACCACACCATCCGCCCGATCGACTTGTCTCCGCCTCTTTTACGTGCCTTCCATGTCTT
GCCGGCCCAGATGTAATGCTGCGGGAACTCATGGTAGAGCAAGGTCGAAGCAGCTGGGTCCACCGCACAGGTCTCGAAAAAATGCGTCAGTTTCGTATGC
CGCGAGTTGCTAAGAACGTCTGCAGCATTGTCGGTTGGCCGAAACGTGACGAAGTTGCTTCCTTCCGTGTGGACTGGAAGCTGGACGACTGTGTGCGACT
TATCTTGCAGCTTGAACTTGAAAATTCTCCAGCACGCTTCTGGGGCAGATACATATCTTCCGTTCTGGTACTCCTTGATTTCATCAATGTCGACTTGCAC
AATGGTTTGGCCATCAGCGGAAACGGCTGGATCAGTCCCGACTGTGACAGTCGCGCGGTCGTGGCCCTTGTACACGTACTTGTACAGGTACTTGACAGAG
TCGATTGTCGAACAGATCTCTACGTTGACATGGCAATTGTACTTGGTTAACAGGTACGGGTTGTAAGGGACCACCCAGCGGTTGTCCAACTCGGCTCCGC
GACGAAGCGTAGTCCTTCCGTTGCCGCGACGCTTGTAAACAGGGTACCCTTTCCCGTCGTGCCGAGTTTCTTCGTTGAACAACTTAGGAAATCCCTTCGA
ACACTCTCCGTCCCTCATACATGGTGCATGGCGGTTGAGCACACCACACGGACCGTGCATCATGCAGCTTGTCACCACCTTATAGAGTCTCAGATGCTCG
TTTGGATCCGGAATCTCAGCGCTGACAAACTTGTCGTAGTCTTCTGGAGACTTGGGCCTTGCGGAATCGTCCAACTTGATCAGCATGTGAGCATGAGGGA
GTCCGCGCTTTTGAAACTCGATCACAAACACGTGCGCGACCACTTTCCCGAAGATCTTGTTCTTCACGATGTCGTCGACAATGGCTTTGAGCTTCAAACG
GAAGACTCGGGCAACAATGTCTGGGCGGTCGGTCGCTTTCTGCCCTGGAAGAAGCGCATTTT