Description :
From Genome Similarity Track
Location :
scaffold_93:30- 17541
Transcript NameFunction/comments
Pl_109936hypothetical protein PHYSODRAFT_248120
Pl_109937hypothetical protein PHYSODRAFT_309401
Pl_109938hypothetical protein PHYSODRAFT_309401
Pl_109939hypothetical protein PHYSODRAFT_343894
Pl_109940hypothetical protein PHYSODRAFT_437914

Sequence
17511 bases(100 bases per row)
GCTGCATACAGCAACGCCCGCACTTTTCATATCTACGAAACTCATCCAAGCTCAACTACACCAGTTTAGATTGGTTTGCAGATCAAACGTTAGCACCTCT
CGTGGGCGGTGATGTTAACAAGCTCTCCAGTGCCTATACTGTGTTACCATTTCAACATACTCGGGTCAGCGCGCGCGCAGTAGCTTGTCACGCAAGTGTC
AAGATCGCCATGCACATTGTGTCTGCCATTGGTGATTGCTGCTGTAGACTTCAGTGGTGGCATCGTATCACTCGCAGGGTAATGGAGGGTACGGGTGGCG
GCCCGCTTCAACGTGTGGTGCTAATCGAATCGCTCAATGATAAGCCTATTAGACCGTTCCAGGCCAACGCACTGCTGCGGCAATGCCTCTATCGTATAGA
AGATGATCTAGTACACTGCATTGCTGCTCTTGTGACTCAACACAGAGTGATTCACACGATCTATACTAACAACCGATGCAGCTCTGTTCGATCTACATAT
AATACTGTTTCTGTTTCTAACTTGGACCCGTCGACTTAAGCTAAATCGACGTCTGAGTTGAAGTTCCATAGACGAGGGACCTGGAACGCCTCATCTATGT
AACTTCAACTTGTATGTGCTTTGATTAGCGAGACCTTCGCTTGCATCAGGCTCGCTCGATGCAGTCTCTGACTACGCAGCAACAACGACAATTCTAGACA
CGAATTCCTGTGCGTAGCGCTACCACTCTTACATTCTTGCGTCGTCAGTGAGCTGAGACCAACAAGTTTTCCTGACGAAGCATCAGATAAGTTGCATTAT
TGTTATTCTGCCTCGCAAAAATGCATCAAGTGACGACACAGACAACCCCGACAATCTACGCCTTAAGATACCACGCAAACGGCTTGTCCGCAACGTACGT
GCAGATCTGCTTGGGCTCGAGGTAGGCGTTCAGGCCGAAAGGTCCAAGCTCGCGACCGATACCGCTCTTCTTGACGCCTCCCCACGGCAGCTCCACGAAA
CACGGCTGCGAGCAGTTATTCCAGACGATTCCAGCACGCAAGGCCTTCGTCACCCTCTTGAGTTGCGCGTCATCCGATGTGAACACTGCAGCTGCAAGGC
CAAACTCCGAGTCATTCGAAAGAGCAATTGCCTCCTCCTCAGTCTTGAACGTCATCACGGACAAGACGGGGCCGAAGATTTCTTCCTTCCACACACGCAT
ATTCTTGTTGACTTTGGTGATGATCGTGGGCGGAACAAAGTATCCCTTGCCACCACTAGGGACGGTTCCTTGAGCTACCGTTGCGCCTTCTTCCTTTGCG
CTCTGGATGTACCCCAGCACCTTGTCCTGTTGGGCTTTGGACACCACGGGGCCCATCTGCACCTTACTATCCAACGGATCTCCCAATACGAGCTTCTTTG
TCTCCTTCACGAGCAAGTCAAGGAACTCATCGGCAAAGTCCTCATGCACCAGCAACCGCGACGTTGCGCTACAGATCTGACCATTGGTCCAGAAGCAACC
AAACATGACCCACTCGACTGTGCGTTCGATGTTGACCTTGTCAAACACAATCGCAGGAGACTTACCACCCAGCTCTAGTGAGATCTTCTTAATATCCTTT
GCCGTCTCTGTCATGATGTTGCGTCCCGTGGGTACGCTCCCCGTGAAGGCCACCTTGTGTACATCCGGGTGCGAGACCAACGGGCCTCCAGCTTCGGCTC
CCAAGCCGTTGATCACGTTCAGGACACCAGCAGGTAAGCCCACGTCGACCGCCACTTGCGCCAACTGCAGCGCGCTCAACGGCGTGATCTCGGACGGCTT
GAGTACCACGGTGCAGCCTGCCGCTAGAGCAGGAGCCAGCTTCCAAAGCGCCATGAGCGCCGGATAATTCCATGGGATGATAGCGGCCACCACACCCACA
GGCTCATAGCGCAGCGCGCCCAGGAAGTCCTCGAGGGGCAGATCAACCTTTTCATATTGACGAGCGTCCAGGGCCTCTGCAGCCTTGGCATAGTACTCGA
AGCATCCGGAGACGTCCTCAATATCCCAGACGGCCTCAGCGAGCGGCTTGCCATTGTCTAGTGTCTCAAGACGGCTAATTGCATCGATGCGCTTGGTCAC
CAGCTCGCCCATCTTACGGAGATACACGGCGCGCTCAGCTCCCGTGGTGGTGCTCCATGTCGTGAATGCTCGCTTCGCTGCCTGCACAGCCAGATCCACG
TCGGCAGCCGAAGCGGCGGCCACCTGTTGGATCACCTCTTCGTTGGCAGGATTCAGTACGTCCATGTACTTCTTGCTGACAGGCGCTACCCACTTGCCGT
CGATGAAAAGCTCCTTGAGTGTCGGGATCGGGTCGCTCATACTTGTCAAGTGCTTGGGGGTCGAATGCAGGAAGCAGTGCAAATTGAAAAATGATCGATA
GGAAGGTGCTGGTTGAAGCGCAGACCTGATGCTGCAAAGCACGTCGGACAAGCACCTTCGAGAGGTGTCAAGCGGACACGTACTTCTAGTCACAGTGCCC
ATCACTCCACCGGCGGGATCATGTTACCCTCACTTCAGGATCGACCGCGTAACACAATCAGCACCGTCGGACAGCAGTGCACGCCGTGCATACATGCACG
AAGTAACCACGCACAATGACAGCAGGATATGTATCAACAATTAGTTCGCCAGCGCTATGATATGCAATTCGAGGCTAGACGTTGCAATACAGATACATGG
ACGCTGGTCCTTCCTTGGGCCCAACTACTCGCGAGAGAAGGCCCGATTAACCTCCGACGGAGCATACAACCCGGTTTTCACAGGTGCCATGGTGTGATAG
CCTGTTTGGCTGCGCTTGACGATTTTTTCACGTACTCCCTTAGGAGCAGCGGGAGAGCATAGTGTGTTGTTTTTGATCTGCGGAACAACATGTTTGAAAT
AGTAGATGCTTCCGACCATGAACACCAACACCGTCACGACGATGGACGCCAGGAAAATGGTGTCACTAAGGCTGCTGTACAGGATGGCGACAATGGCCAC
ACCGCAGAGTGCAATGCCTAGTATGGCTCCGGAGACACCGAACGGGCTGCGGTAGGGTCGAGCACGCTCAGGTTGTCGAACTGCTAGGTAGATGTACGAT
AGTAGCTGAAAGATGTACGAGATGAGAGCTCCCAGTAGTGTCAAATTGATCAGTGCCGAGCCCAGATTGGCGTCGCCAATGGTGTAGTGCAGCACGATTG
CGATGGCCTCGCACATGACAGTTCCGAAAACCAGGGCACCCACTGCTGTACCGCGAGTAGGGTGCTCGTAAGCGAGGAACTTTGGGAAGTATCCGTCCTT
GGCAATGGCGAACAGCAACTGCCCCATGAAGAAAATATACGAATTGGGGCTGGAGGTCAGAGCGATGACTGTCAACCACTTGAGGACCGTTGTTGTGGCC
CCGTTGCCGAAAATGGTCTGGAAACTAGTGACGAGAGGGGCTGACACATCAGCCATGGCCGCAGCACCCGGGGAAATGAGGGAGCTGCATGTAGCGGTGC
CGAAGGATAGGAAAACCAGAGTCGTAATGCAGAGGAGCAGTCCTCGCGGGACATTCTTCTCGGGCTCGATGGTCTCGTCACTGGCGAGTGGGAGCTCCTC
GATGCCCAGGTAGAACCACATAGCGAAGGGAATAGCGTGGATGACACTGTCCAAATTCGTGAACTCCCAATGCTGCTTGACCACCCACTCTTCATAGTCG
AGATACGGGATTGACGCGACGAAGAAGAAGAGGAGTAGACTCACACACAATGTCGTCGAGCATGCCTGCATTCGGAACGACGCCTGCACCCCGAAAATAT
TCAGACTCAAGAACAGGATGCCGAACGCGATGAAGAACACGGGTGCAAACTTGACGTCGACATTGAATAGTGCCTGCAGGTACGAGTACACGGTGTAGAA
CGTCGACGCGTTAACGGCAATGACTTTGAGTGTCTCAGCCAATCCACTGAAGAAAGCTGCTCGGGGTCCGATGGCATGTAGTGCGAAGATGTAGGGCCCT
CCTCCAGCTGGGATCGTCGCCGACAATTCGGCGATGGAGAATGATAGCATCACGTAGAGCACTGTCACCATGCAGAGCACGAGGAGCATTCCATCGAAAC
CGGCGATTAGAGCTGATTGCCAGCCGTAGTACTGTCCGCTGATAACTGCACCGATGCCGAGGGCCCACAGTTGCGGGGCTCTCGCGTATCGGTGCGGCGG
TGCCTTGCCATTCTGAACGTCGACCGAAACACAGTCCCCACGGCACATCGTAGCTAGCTAGCTTTGAGGCTAATTTCCGAGTGTTCTGCAGAAGTTGTCG
TTGTGCTCATCACTAGAACTGAGAACGCTGTGCGCCGCCCTCATTGGCTTTCAGAGTGCGTCACCGTTCTTCAAGCAGCTATGGACTCTGTTTGACAAAC
AACTATTACCAACAGCGCGCCTTATGGAGAGAATCGCCAGCTGCAGACCGTAACCTTGCGAGTCTCAATGGAGTTCCTTCTCTCCGCAGCTCAAAGCCCT
GGGCACGGGTTGCGCTTAGCAGAAGCGAAATTTCACCATGGATAGACTACTCAGGAGCTATCGTGCATTTCGGGAATTGGTGTCGCGAGACCTCCTCGGT
GTAGCCCTGACTGAGATTCTTAAGACAGTATTCGTCATCGCTTGGAGTGGCTGCAAGCAGACCGTCGGATAATCTGCTTTGTCGCTTTGTCGGGAGTTGT
TCCGGTGGTGGGCTACGTCCATTTGGTGCTTGGTTGCGATGCCCGACGCAGTACTATGCAGCGGATAACCAAGTTGAAGCAATTCCCTTGATCCGTTGGC
TCTTAGTGAGTTTGGTGTTGATTTGGTGAAGGTAAATGAATGATTCGTGTTGACGTGTAAATTATAAGGTCAAGAGGATTAGATGGATGTACACTACATG
GTCACTGAGAAGAGCTACGCTCCCGTCGAGATCACCTGGCTTCTGGCGCTCAAAAGATTCTCGTTCATGTCTTTGGTGACTGGTGAGCCGAGGGTCTTGT
TCTCGATTTTAGGCAACACAACTCTGAAGAAGTACACGCTGCCAGCGAGGAACACCAGTCCTGTCACTATGATCGACGCCAGGAAGATCGTGTCGGTCAC
ACTTGTGTACAGGATGGCGAAGATGGAGATACCGCATAACAACAGGCCCACAAAAGCTCCAGCAAGACCGAACGGGCTCCTGTACGGCCGGGGACGGTTG
GGCTGTCGGTACCGCAGGTATACGAATGACAGCAGTTGAAAGATGTACGAAATGAGAGCCCCCAACAACGTCAAGTTGATCAGCACGGAGCCGAGGTCGT
CGTCGCCAATGGCGTAGTGCAGAACGACAGCGATGAGCACACAACTGATGGTGCCAAAAAGCAGCGCGCCGACTGCCGTACCCCGGCTTGGGTGCTCGTA
CGCGAGGAACTTTGGGTAAAATCCGTCTCGAGCGATGGCAAACAACAGCTGACCCATGAAGAAGACATACGAGTTTGGACTCGAACACAGAGCTATGACT
GTCATCCACTTGAAGAATGTCGTGGTGGCACCAGTGCCGTAAATCGTTTGGAAACTCGTGACAAGTGGGGCCGACACGTCAGCCATAGCAGCAGCACCCG
GTGCGATCAATGAGCTGAATGTGGCGGTGCCGAACGACAAGACCGCGAGTGTCGAAATGCACATGATCAACCCACGCGGAATGTTCTTCTCGGGCTCAAT
GGTTTCTTCGCTGGCCAGTGGGAGCTCCTCGATGCCCAAGTAGAACCACATGGCGTACGGAATTGCCTCAATGGCACTGCTCAGATCCGTGTATTGCCAG
TCTTGTTCAACGACCCACTGCTGGTAGTCCAGCTGCGGGATGGCGGAGAAGAACATGATGAGCAATAGCAGCACACAGAGCGTCGTTGAACACGCTTGCA
TCCGAAAAGATGCCTGCACTCCGTAAATGTTTAGACCGCCGAAGAGAATGCCGAAAACGATGAAGAACACCGGTGCGAACTTCTGATCCACGTTGAACAA
TGTCTGGAGGTACGAGTAAATGGTGTAGAAGGTGGACGAGTTGACGGCGATCACCTTGAGCGTTTCCGCCAGTCCACTGAAGAACGCTGCACGGGGACCG
ATCGAATGCAGCGCGAAGATGTACGGGCCACCACCCACTGGGATCGTTGCCGACAGCTCGGCGAGAGAGAATGACAGCGTCACATATAGCACTGTCATCA
TCGACAGCACGATGAGCATGCCATTGAAGCCTGCGACGAGTGATGATTGCCAGCCGTAGTACTCGCCGCTGATGACAGCTCCGATACCAAGTGCCCAGAG
CTGCAGCGCCTTTGCATGTCGGTGTGGAGCTTCCGCCTTGGTTTCTTGGATATCGATGGACACACCGCTGATTCGACTGAGGCGGGACATCTTGAAGTGG
AGTCGTTGCAGGACCACAACAAGGACAATTGGGAAGTGAGCTTAAGCGTTGCTGGCGAGGAAAGCGAGCACGGAGGAGGAAAGTCAGCGCATTCTTGTCC
CTCAAAACCATCACACTCGACGGGTCTGCCGACTCTACTCGGTCCCTGCGGAGACCTTGCTTGAGCCTCCGTTATTGGCCGGTGTATCGCGTCACGTGCC
ATCTGGTGCACTTCAACACGCATCGGTCTGTAACACCGGAGGTGATCGGCGGCACAGACAATGTGCAATGCGTGCAGTCCTGGACTCATTGCTGTCAACA
CTGGGTGGCGTCCTTGGAAGATCGACTTCAATCTAGGCTTGCTGTAGTCTAGACTGGCCAAGGTTATCTTCATTTTTCGAAGGCACTCTCAAGTTCGGTC
ATGGCCATGGTCAGTGGTAATGAATTTCTCGTTGTTCGCGTTGCAGTGGTCGTTGCAGTACTTGAGGCGGTAGTATTGGTGGCCGTATATTCTGCGAGAC
TTCGGAGCGACGAGGAACTCCATTGCAACGTCGAAGCTTGGACCGAGTTCAGCTGTTTGTGGCTTGTGAAAAACCGGGGAACTTGGTCAGACATGGACAC
CTGCGAGCGTACGGCGATCGGTTTAACATCACCGTCTTGCCTCCTTCAACTCGAAGTAGAGCGAGAGCATCGCCACGAAGGTCCTAGCTTGATAGACTGC
ATCATGCCGAAGCAAAATTGGAGATGGCGTACGATGTAGTGACCATCGTGCAGAGTTGGTTTTCCGTTTCCTCGCTGCGTTAATTGCTCACCGTTGTACG
CTGCTCATTCAGTTTATCTGGTCGTCACCGCTGATGATGTCTTGGTTCAGCCAGTCGCACCGGCATGCAGCATCAGCATACAGCATGATCATCACTGCTA
AGCTGCCTCAATGCGATGATCACGCTACGCAAATGGGGGATGCGTTAGGCCATTTCGAGCGTATCATAAGCCAGTCGACCGAAGTTGACGTGCTGCCGAT
CGCCCTAATGTTGAGATGGGGTTAACTTGGTTGCTTTCCTCGTCCTACCAACAAGCCATTACTTGACCCTGCCAAACTTTCTGACACAGACAATCTTGGC
GCATTCATATTAACAAGAGCAGCATTGGTGTGCTCAACCAGTAGTTTCCGACTTCTTACGCTTAGGAATACATTATGTGGTTAGGACAAACCGCAAGTCA
TTCATCTGTATGCGGATCGTTGTCCAGTTATGGCCTCTATCGCGTTCATTTTGGTCGGCATGCATGAACTTGACCATGTCATTAGCTCCCTGACAAAAGT
TGTCAGACACTTGTCAATCCATGGTGGAAAGTTATCAGACGACTCTGCACTCTAGGGTATTGCATCGCACTTGCCATGTATGACTAGATGCGCGTGCAGC
AAATGGGAGTTTGAACTTGACCACCATCTGGCTGGCCCCTATACCGCCGATTTTGGTCTCCGTTCACCCGATGCAGCTTTGACGATCAAAACGCGTAACA
TCATCCAGGCACCAGCGGCATAGATCGCGGTGTAATGCAGCATTTCATGGTGCTCAAGGGTCCAGCCCAGCTGGAAGACACCCGGTAGATTAAGCATGGA
GGGCTCGGGGACGTGCATGATAGCGACGGCTTCCACGATCGAGTCTCTCACTTTCGGATTTGCCTCCGCCTACACTCGTTCCTTCCAGCGACCCTGCCGT
CATGGCTCCCAGTGTTCACATCCCCGCCAAGAGCATTAAGCACCCACTTGACCCCGTCACGGCCGATGAGGTTCGCATAGTAAAACAAGTGCTTGCAGAC
GCCGGGTATTCGAGCCCAGAGCTACGCTACGCATACGTGATGCTGTTCGAGCCCGATCACTCCACACTGGCCAAGTTCGAGACTGGTCAGTTAACGGAGA
TTCCACGTGAGATCGGTGTGCTCGTGCTCGATCAGACTACGAACGTCACGCGCGACTTCGTGGTGGACGTCGTGGCCCGCCGCATTGTTAAGGAGGTAGA
ACTAGACCCGAAGACCGACGGACAGATCCCCATCCTAGATCAGGACTACTGGGACGGCGACTCCATTTGCAAGGCCGACCCGGACTACGTCGCAGCGCTG
GCCAAACGCGGCATCACCGATCTCGATATGGTGCGTGGCGAGCAGTTTTCGGCCGGCGTCTTCGGCTACGAGGGTGAAGAAGGCAACCGCATGATCCGCG
TGCTGAGCTTCCTAAAGGTTGAGAATACACACGCCATGTACGGCCACCCGATCGACGGCCTTGTAGCACACGTCGACCTGACAAACCGCAAGGTGCTTAA
GCTGGTTGACACGGGCTACACTCACATCCCAATGGAATCTGGGGATTACCTGGATCCTAAGGTTACTGGACCCATGCGCACAGACATGAAGCCTCTGCAC
ATCAAGCAGCCCGAAGGTGCCAGCTTTAGCGTCAAGGACAACATCGTGTCGTGGCAAAATTGGGAGATCCGCGTCGGCTTCAATGGACGTGAGGGTCTCA
CGCTTCACGACATCTCGTTTAGTGACCGTGGTCGCAAGCGAAAGATCCTGAACCGTGCGTCGGTGTCCGAGATGGTAGTGCCGTATGGCGAACCATCTCC
CACACATGACTGGCAGAACTACTTTGATGCTGGTGAATACCAGTTCGGTCGTCTAGCGAATTCGCTAGTGTTGGGCTGCGATTGCCTCGGCAAGATCCAG
TACCTGGATGCTACGGTTGTTGATGACTTCTGTGAGCCATTCGTGATCAAGAACGCTATCTGCATGCACGAAGAAGACTTCGGTACGCTGTGGAAGCACA
CGGATGTGTTGGCGTCCCCACCCACTGGCACGGTTCGCCGCCAGCGTCGCTTTGTGGTATCATTCTTCGTGACAGTCGGCAACTACGACTATGGCTTCTA
CTGGTACTTCTACCTGGATGGCAGGATCGAGTTGGAGTGCAAGGCCACGGGCATTGTGTTCACCTCTGGTCGACCAGAGGGTGAGTATGAGTACGCGACT
GAGATGGCTCCGCGTCTTGGTGCTCCATGCCATCAACACTTGTTCTCGGCACGTCTAGACGTGGCCATCGACGGCAACAAATGTCATGTTGATGAGCTGG
AGGCCAAGCGCCTTCCAATCAGCCCCGAGAACCCTCGCGGCAACGCCTTCATCCGCACAGCAACCCGTCTCAAAAACGAAAGTGACGCCCAGCGTGTGGC
AGCAATGGACAAAGGTCGAGTATGGCGTATTGCTTCAAGCGAGGCTAAGAACCGTCTCGGTCGCTCCACGGGTTACGCGCTCTTCCCAGAAGGTCAACCA
GTGCTTCTCGCTGCGGACGGCTCGTCCATCTGGAAACGCGCTAACTTCTCGACCAAACACTTGTGGGTCACCAAGTACGCGCGCGATGAGCTGTGGGCTG
CAGGCTATACACCCAACCAGCACCCGGGCTTTGCTGGTCTGCCTAGTTACGTGAAGGGCAACCGCCCGGTTGACGGTGAGGACATTGTGGTTTGGCACAC
GTTCGGCCTCACGCATTTCCCGCGTGTGGAGGACTGGCCCATGATGCCTGTGGACTATGCAGGCTTCAAGATGATCCCTGAAGGTTTCTTCGACCGCAAC
CCGACACTAGATGTGCCTGAAGACCCGAATGGCAAGGATAGCTCTGATCTGCATGGATGTTGCCATGCAACAAAGGAGCCGATAGCGGAGCCGTAAGTAG
CAGATAATCCAAAGCCAGTCAGTTTAAATCGTAGTGTGATAATAAATGGGAATGCATTCATGACAAAACATGTTATGGCCAAGTTGCAGCGAGGAGTGAA
TGTTATCAAGTTGAAGTAGAAACATTCACTCCTCGTTGCAACTTGTGGGTCAAGTTGCAAGTTCCGTCACTATCTGATGCAAATCTGATCCCGTGCTGCT
AAATGGAGGACGCACCTCTTCCAGCCACAGACGTCGCTGTCGACTCGAACTGCGATCCTCTCGCTGACGATGACACACCAGACGAGTCTCTAAACCCTTC
TACTACTTCCGAAGACCCATTTGCACCTCAGCAGCAGCCAAATTGCGACGCATCCGAGGCACCAAATGCCGAAGTGTTAGCGAGCGCCCCAGATCTACGC
CGGTCCTCGTCTTCCAGCGGTGTGGCCGCTTCACGTGCTGTAGGCTTCGGGATCGTCGGACGACGCAGCAGAAGTCGCAGTGGAGGAGATGACGGTGATC
GCGCGTCCTCGGAATTGGTGCTGCAGCTTCAGAGACTCTGTAGACGCCAGAGACAACGCTCCGAGGAGCGCGCCTTTGTAAGGGACGTGGAGCGCGTGTT
AGCGCTGCTAAGAGCCCCTACAAGTACAGACGTGACGTCAGCCACGTTCCCAGGTCCAGATAGAGAGATATTGAGGAGTGTACAGGAAGAAGACGATGCT
GTTGATGAGAGACGAAACTCCGCTATGAGTAATATCTCTACAGTTAGTAGCAGTAGCTCTATGAACTCCAGTGACAGACTACACATGTCGAGAGTGATGC
TGACACTTGCGGAGATTGATGCATTGCTGGATTGTATTGCTGACTTGTTCGACCATCGTAATCCTGGAGTACGAAAATTAGCTTTTGAAGTGGTGCAGCT
GTGTTTGCTGCGATTTGGAGAGAGATTGACTCCTGCATTGAGGAGAAAGATCTACTTACGACTGGAAACACACCCTCCTGGAGACTTTTTGTTGCGGCAG
AAAGCGCTTCGTGCACTGACGCAGGATGGACGACATGTGGAACCTTTCCATGTCGAGTTGGGTTGGTTTCTGCTACGGTTATTAGAGCAGTCCGACGCCC
AGCGCGATCTACTGGGACTTATTCAGAGCATTCTGCGTCGTAGTCCACGAGCATTGGATCGTGACAAGGTGATTGCTATTGTGTCAGTTATAAGTGCGCG
GTGCGATATGGCTTGGAGTCGCAGTGATTTAGATGCTTGCCACAGATTCGTTGCCTTTTACCATGTATTGGCAGCACATGATGCAGCGTATGCAGCTAGT
ACCCCGGCATGCTTGCGGTCACTATGTTGTCTTGTAAATGCTGATGGTCATGGAACGTGGTCGGTAATGAAGCTGTTACTAAATGGAAGCTCAGGTTTCC
TTGTGCTGCGAGGGTTACTTCAGCTATTGGAGCACCCGACAGGAGCTAACTCGCCTTGGGTACTCCGAGGCGCCGTATTTTTTGTTGGTATGTCTTGCTG
GGGTTCCCAACGAGTTGCTAAATTTGACGATATTGCGTGGGCTCCCATTTTACTGGCCCTTGAGCAAGTGTTGCAATGCTGCCGAGGAGTGGTCATATTC
GAGGTTATCTTGTCTATACAGCGTCTTATCAAGAAGTTTGGTGCAGCACATCCATCCGCGGGTAGTGGACAAACCTCTGCAGGTTCGATAATCGCACCAG
CAAAATCATCATCGTATTCAGGCGACAATAGCCATGACACGGCTACAGCTAGCTCCTTAAGCCCGATCAGTAACCGGGATACACGGCGCTTGGTCATGGA
ATGGGATATTATTTTGCGTATGCTACAAGCTCTGAGACCATGGGTCTCTATGACGGATGAAAATGAGATCGAAGAATCTCCTCAGCGGCCTGTCCACTAT
GGCAACCGAAGGACAGAACCAAATGTACATCACACGGATGCAATTCACCCAGCGAACGATGTCCCCGATCAACCGCAGCATCAGTTATCGGTCTCAATTC
AGCAGACTAGAATTCCACGCGAACTTCTTGATACTCTGCAAGCTGTGGAAGATCTTGTGGAACAGCAACGTTTTGCTGGTGATGTGGACGAGTTTCTTAA
TATTCTCGAAGATTATCTACCGCATCTCAGTGAAAATTCAATGCTCTTTTTGTTGCGGCAGCGTGCCGAGGCAGCTCATCCTGGATATCATTTGGACTGG
TTAACTACTTTGTTGACTGCAATGCGTACATTTTTCTCGTGTATTAGTTCTGATGGAGATGCTCTTCCTGTACCAAGTACAGTGCGCTTGGAGGCTCTCG
AAGTATTACGAGTGAATCTTTGGACAAGTCGCAATGTCTGCGAGGACCGCGTCATTGAAGATGTAGTGATCCCGACACTCGGTCGAGTATATGAAGATCC
AGATGCTGAAGTGCGACGTCGTGCTCTAGGATTTATTATTGAAGTGGCCCGGCAATTGGAAAGTGTCAAGTTTGACTCGCTATTAGATATCCTTGCCAGT
GCGATGACGATTTCGAGCAATGAAGATGCTCAGTTTGTGGCTGCTTCGGGTATTGTGTCACTTTTTTCTTCTGCTTTTGACCATTTGCCTCCGGCTCGCG
CAGTACGCATGTATGACCTTCTTGCCACGACAGTGGAAACCCATCGAAGCCGTGCTATTCGTCATGTTGCTCTATCGTGTCTGCTGAATGTGTGCGAAGC
CCGTTCGACTGACGGAAAGCTTCAATGGAATCAGCAACAAGTTCGAACATCGCGTTTTCTGTTTGTATCTCGACGTACTGCACGTATCAACGCAACTAGT
ATTCAATTAACGGCAGCTTGTGTGCCGGTAGCGCGTGCGCTGCGTGCTCTCCTTACACTGGTAAGTGCCGAACCTGATGCTGAGCTTTTCCGTATGGCTG
TAAAAGGTATCAAAACCATGATGGAAAATCGTGTGATTTTGGAAGACGTGGATATTAGCGAAGTGTCAACAAAGGTCGTGGCCAGTATTGACTATCGGGC
TTTTGGTCGAGCTGCCATTACTGACGAGATCGAGAGGATGTTTAGTGATCAAGCGAATGAGCAAAATTCAGTCGATGCAGACACGTTGGTTCGTCGAGTT
CAAACGGTACATGGAGATGCTAGTCGTTCAGTTACCCAGACTGATGCGGAGCTTCTCCGCTCGATTCATGCATCAGCAAGGTCCATGAGTACTGGCGGGA
TTGACAATACGGATATATCGTTCTTTAGGAATGTACGAGCGACAGCTGCGCTGCTTGCTAAAACACGATTCCTTGCAATGGGGATCGAATTGTTGCAGCT
TCTTGTTAGCTATGAGTCTGGGTTGCACGAGAATGCGCTACAAGAGCTTACACGATGTCTGGTAGGTGCAATGGAGTTACGCCTAGCAGTTGCTGAAAAA
GACTTGTTCGCCGGTGGTTCTACTGCTGACGAATCGACCTTATCTTCATCGTCATCTGCTCCAAACATGCTGTATGAGCACGACGAAGCAGGAACCGATC
TTGCTATTCCATACGCGCCTGGCACCCCACTAGGCTTCACATCCCGTGTGTTGTCGCGATTTCAAACTTCTGCATCTCATGGTAATCTATTTCACGCGTT
ATCGGGGTCTGTGAGCAAAGCGACACTGGGGTCAACATCAACTAACACCAATACCTCACAAGTACGCCCAACTCGCAAAGATCGAGCGCGGCTACAAGGA
TTCCTGCGCGAACTCTTTGACTCCGAGTTCACGTTGCTACACAAAACCACAACAGCATTGAGTTTCTTGGTACTACTCGCACCGACCACAGCATTGGGCC
AACTCGTGGAAATGCTGCAAAACTTGCGTGGATGCGTTACGACGGTGGGCGGTGATTTTCGACCTGACGCATTTGTAGCCGTATTGGAGTTATTGGGAAC
TATAACACCTATGCTACATGCACATCAAAAACACAGTGTGTTTTCTGCCCACAAAGCGATTGTAGAGGCTTTGCTACTGGGCTTCGAATATGCAAAATCG
AAGCAGCTTGCTTACCTCGCTTTCCGATTGCTGTGCCAAGTGATTTACCAAAGTAATCGCAAGGAGCGAATCTCTCTTGCTGCTCTGGCGATGCCAACCT
TGCAACAGTGCACACGTCGCGCGAACAGTCTTCTTGCTGAGGCAGCTGTCGATTTCTTGATGTGCTATGCGTACTCCCAGTCGGTTTTACCCCCATCGGC
ACTTTGTACTCGACAACAGCGTGGACACGAGGGGAATCGAGCGATGGATGATTCGTCTCAAACCAGATCAAAATCCTGGGTGTACAAGAGATCATTACTT
ACGATCATCACAAACTCGCGCGGGGATGCATCACTCGTAATCAGGAGAGCTAATTGTACGAGCCATTGGGAGCTTGATTCACGTCACAATCTGTTGCTGG
ATCCGGCAGACTCGCGCCAATTATTTTCGAGTTCGTGTGGTGTGCGTAATGAATCTGGTAGCTATCCAAAAAGCTCTGATAAAGGATACCAGCGACCAAC
GACGATAATTGGATCAAGAAATACTGTCGCCCATAAACGGTTAGCACTCCCGGCAGAGCTCCGACCGTCATTTTCGAGCCAATCGAGCTCGTATTTTAAA
ACTAACGCTCAAAGTTCAGATACAACAAAGAGTAACTCTCGCGCTGAGGATGATACAAAAACTGTGGTGGACATGAATTTCAAAGACATACAGGTGGATT
TATCTCTGGATGATACGGTGGCACACTCCTATCAGCACTCAGCTGCGGCATCAGCACTACCACGACCGCTCCCAGCGTATGATGGCATTGGGGGATCACC
ATCGTATTATTATGAAAATGCACAAGGTACGGAAAATGGTGTGAATACGGTATGTTTAGGACTAACTTTATATGTATTTGCATCGTTTTTGGTTGTAGTG
AGTCGCCCTAGAAATAGTACAAGGCATTCCAGGCAATCTGAAGGAGACGATGGACAAGAAAGTTCGTCAAACAAACCTACTATTCGTGCTATTCGGGAAG
ATGTCGAAGAAAACGATGGCACCGAAAGCCAATTACGACATGTGGAGAATGACCAAAGTGGAAGTGAGATGGATGCATTTTCACTCGATGACAGTGTCAA
GGATGCACGCTGTGTTCCAGAAGTTGCACCACGATCCCTACAATATGCTGACTACAACACATCTACAACCACTGGATCAGCTACCGCCGGAAAGATGTGT
GAGCCCTCGACATTGCATCGTGAGAACCAGTACGACCCCATGTATTTGATGATGCAGCTATTCGATCTTACTATGGAAAATCGGCCCCAGTTGCTCATGG
ATGGGCCATCACTGAAGCTGGCCCTCAGCGTGCTGGATCGTACTCCAGAGTATGAGACGCACAAAATTGGCTTGTTGTACGTTCGAGGTGAGAAGCAATC
TTCTGAATCTGCCATCCTAGGGAACACAGGTGGATCGCTTCGTTACTTGCAATTCTTACGTCGTCTAGGCACCTTCACTAAATTAGAGGGGCTTTCTGGA
TACACTGGAGGGCTTGATACAACAAACAACAGCGACGGTAAATTTGGTCTCATCTATAAAGATGAATGTGCTCAGGTACGTCCTGTTCCTTCAGAGTATA
CAACCGTGGTGTACCTTAACTAATACTTGTTTTGATGACATCTTTGTAGATTATGTTTCACGTTGCAACGATGATGGTTCCTAGAAGTAGTGATTCTGAT
GGGATTTCTGCTGCGGATAACTTTGCTTCGATGAAGAAGAAGCGTCATATTGGTAATGATTTTGTGCATGTGGTGTTTAAGGTACGAGCACAATTTCAGT
TAAAAGTGAAGTAAGTGTATCTGACTATGAAGGTTATTTTGCTGTAAAACAGGAATACGACGAAGATTATGATCTGCAGACGCTCCCTGGACAGTTCAAC
GACGTGCACATTATTCTTCAACCACTAAATGACCGTGAATACCGTACGGAAGTGCACGTCAAACCAGGGATTCCACCATTTGGGCCGCTTTATGGTAGAC
AGATCGTCTCCAGCTCTATTATCTCGGAAAGCGTGCGGCTCACATGCCTAAACGCTAACTTAGCTTGCCAAGTTTTCCATCAAGACCTAGTGGGTTTCAC
TTTGAACTGTGAAGAGCGATTGAAACAAATTAAGCAGTTGGGCCTTCGACTCGCCACCGCGGACGAATGGAAACTTGATGATTGATAAGACTATGGCATG
GATATGGTGTCGTTGAGAAATTGTGAACAACCATATTGCTGGCGCGTTGCCTACATAATTGCCGTTGAAGATTATTCTATTGATATAAATCGCAGACAAG
CAAAGTGTTTACACTTGAAAGAAGCACGTGGTTACCACCGTGGTAGTGCAAATGCATTGTGACAGCAATCACAACTTGTACTGCCGATAGGATATCGCGA
TCCTGATTTACCAAAGATCCACTGCCAAGATAAGTGTAGCTCAGGGAGTCCCTGCGGTCGGTCTCACATAATCTTCAGCTTCGCGATTATCAACTCAGCG
ATGTCCATGAATCGCATTCGCCATTCCAGTACACGGTGGCACAAAGACAATTATCTTCCACGTGTATTCCACACGGAAGACCGCCGGGTGACAACCTGGT
GGCCCGAATCAATGCCTTCAAGAATGCTAATAAGCACCACCTGCCCCTTAATCGCGGTCTCAATCTTCAGATTGAGTTAAGTGGATACGAAGTAGAGACT
CGACTACTTATCAAGCTTGCAACTATGGGACATATTGTTAACGTGCTGGTACGCTTTGGTTGTGTACTCGACGCTTACCTAGAACAGTTCCCGGTGGAAG
ACAACGGTTGGCCGGATTGAAGACAGGAACTCTTCTTGGAGCGTAAGGAACGTGTTCACAATTTTCGCGAATGGATGGAAGACATGGAATGGTTTCGTGC
ACAACTGGGGGATGAACGACAACAATTAGAGCTGGTTACATTAATGAAGTATGATCTTACAAAGCACTACGCGGTCCTGACCGACTATGAGATATCACTT
ATCGATGACGTCTACACTCTAGTGGCACGTCAAAATGGGATGGTGGTGAACGAGCTTCCTGTGTGGTTTTTATCACCATGTGAAGTGCTAAAATCGCGAT
GCAATCGATACCTCCATGGTGTCCGTGTAACTGAAGTTTTTAGTAATACTGGATGTACCGAGGAACACTGGGAGGAGGCATGTCTGAGGCAAGCTGCACT
TTGGACTAGCTTGAGTCACCCGCATGTTGCGGTGCTGCTGGGAGCGTGTCATGTGGGAGCAAAACCATATTTTGTGCATGAGCCGACAGAGAGAAATCGA
GCTAACGCACACTTATGGGAACCGCTACTCGGTTGTGGTCTCGCGCTACAGTACTTGCATGAACAAGGGCTAGGCTTCTCAAATCTCGTACAGGAGACGC
TCCTGGTGCGA