Description :
From Genome Similarity Track
Location :
Scaffold_4177:30- 1435
Sequence
1405 bases(100 bases per row)
CCGATCCCGACCGTACAAGTGGATGAGGATCCGTACGTTACTTTAGTTTCGAATGGATCCGCTCCGCGTACGACCGCGGAGGAGGAGCATACAGCGGCAA
TACTGTGGAGACTGCCCGGGATGGGGAAGTTGTACGGGCCAGTTTCCACTAATGCAGAGGGCCTCACGTCAATGAAGCACGGTATAACGGGCTCCTGCTG
GGTTGGATTCTACTAAAGGACAGATTCAAAAGAGCTGGTGATTTGTGGACATTCAAACTGGGTGATTCGAGACAGTTGCGAGGTGGAGATGGACTGCCAG
GGCCCGGCCTAACCACTTTTACGGCCGAAGGTGATGATCACACTCGCGTGGTGAGAGAAATTCACGAGGTGGTACAACGTTCAAGGGAGATTGGAATGCC
CATGGCAGTTAGGCTTGGGCCAGTGCCGCTTTACGGAATCAATGTGGGGTTGGGGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGAC
TAGACGAAGTGGTGGTAGTGGGATCCAGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAGCCCCCAAATTCTCGA
GGAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTA
CGAGACCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGATCTGAATGACTTGCTCTTCTATTGCTTCCCTACGAAGA
GAGTCAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGCCTGGAAGGCGGACA
TCAGGGTATTGGTCGGATCTACCAACGGATCCGGGAATGTTTCCACTGGAGAGGACTATTCAAGAGCGTACAACGATACGTCGGTGAATGCGTGGATTGT
GAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATATCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGT
TGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGATCTGTTTACCGGATACGTGGTAGCCAAAGCTAGGGCGTCTAGAACGGCGCAAAC
CATTGCTGAATCGTACGAGGGAGTGTGTCTTCCGAAGATTTGGAGCTAGCGAAATGATTAGACATGATCGGGAGCCAGGCTTTATGTCCGATTTCTTTCG
AGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGATCGGTCGAGCGCATGATGCAGACAATCACGAGA
GCACT