Description :
From Genome Similarity Track
Location :
Scaffold_2483:30- 1234
Transcript NameFunction/comments
Phymu_g14143hypothetical protein PHYSODRAFT_480856

Sequence
1204 bases(100 bases per row)
CCGTACGGCGGACGTCGGCCTGACAACTGGATCCTAACCTCATCCGCCAGACACATCGTTCCGTCGGCCAAGTCCAGACGGATCCCGGCGGGGACCATGA
AGTCCATGCCCAGGATCGCATCCTGACCTGCCAGGGAACCAACCCAAGCGTCGAAGAAGTACACGAGATATCCAGCAAGCGTGGCCTTGATCGTGGTACG
TCCCAAGGTCGTATACACGTTCTCCCCGATTCCTACGCATTCTTGTCTCTGACTTTCATATGACACAGCCAACCTTAGGAGCAAAGGTGGTGTCCACAAT
TGAGACTTCTGCGCCAGAGTCCAAGAGCATCGTGGCCTTCGAGTTGTTGATCTTCCCGGTGATCTTCGCCTGTTTGAACCACTTGCCGGGCGAGTAGTAC
TTCCAGTACCCTCGCGATTCGCCTGGGCTCAGCTCCCACCCGAGATCCGGTGGGGCCCTCGCCAGCGAGTTCACGGCCTTCAGTTCTCCCGGCTTCGGGT
CCGGAACATGATCTCTCCAGTATCCACGGTTCTTCCCATCAGCCAAATCCAGTTCCATCACAACATCCGATCGCGCATACTCATCTTTCCGTAGGCTCAC
GATCGTGAAGGTACGTCTTCCATGAAATCCACGTGTATTGTTGATAGGTTCCTTCGGAGAACTGACCTTCGAGTTTGCTTGCCTGTCAACGTATGCAAAT
ATGCAGAGCTTAGAACGCTCGGCTCGTACCAGATTCCAACCTGGCGAGCGTTCTAGTTTAACATCTTCTCCGCTTTCGAGGGAAACATCCCGGCGTGACG
CGTGGGATCATACCACTGGCGGATCAAGTTGTAAAACTCTTCCATCGGACATTCACCAGCTTCGTGAACTTCACCGCACGCTCGGCACACGTACAAGCAA
TGATCACCAGGAtggcctcttcttccacactTCTGACACGTCAGACGCTTCCANGGTAACACTTCTCCACTCGCTCTTCCGTCCGGGGACGAGGGGGCTG
ATCCGGTTTATTCGGCGGTCCCTGGGGATCGCGACGTTGCTGAGGCTGATCTTCCGGCTTCCGTTGATCcgcgacagcagcgaggtAGACTTGAGATCGA
CCTTGTTCCAGGTCCGATCCTCCGGAGTCTGACTCTGAACCAGAACTGCCGTGGTCGTTCGTCATGCGGATCGCGCGTACAGCTCGGGCATGTTTGGATG
AAGC