Description :
From Genome Similarity Track
Location :
Scaffold_697:30- 1123
Sequence
1093 bases(100 bases per row)
CTGAAAGATGGATTCTATCAGATTCGTATGCGTGAGAGTGATGTACCATTTACAGCAGTAAGCACCCCTAGTGGTATGCTGTGGGAATGGTTAGTGATGC
CACAGGGACTGAAGAATGCACCCGCGACCTTCAATCAAGTGGTCACGAACGTTCTTCGTCCTTTACGAACATTCGCACCGAGTTACTTCGACGATATCTT
CGTTCATGTAAGGCCACGAATGGGAGATCTGATGTTGATGTTCATCTTGATCATCTTCGTCAAGTCTTTCAAGTTATGCGCGAGAACAAACTTTACGCAA
ACTTGAAGAAGTGCATGTTCTTCTCCCCCGAGATCCCTGCTCTCGGTTGTTTTGTGGGCAAGAACGGTGTTCGAGTCGATCCTGAGAAGGTCAAGTCTAT
TGACGATTGGCCTATTCCTCAGAACGTCAAACAGCTACGTCAGTGGCTGGGTTTGGCCAACTATTTGCACAAATACACGCGCAACTACGCAGCGTTAGTG
CAACCCCTCACGAGTCTTTTGAAGAAAGAAAATGAGTGGGAATGGTCAGAGGAACATCAGGCAGCGTTTGCCGAAGTAAAGAAGAGCTTAAGAGAAGCTC
CTGTCCTAGCTCTCGCAGACCATGAGAAGCCGTTCCATGTAGCCTGCGATGCGAGCGATTATGCCATCGGGTGTGCACTGATGCAACACGATGATGAGGG
CAAAGAAAGAGTTGTATCGTATCAGTCACGACAACTCAGGCCCGCCGAAAGGAACTATCCAGTCCACGACAAGGAACTATTGGCCATGAAATATGCATTG
GCAAAGTTTCGAGTCTATTTGCTCGGTGAAAAGCAGTTCGCTATTTACACTGATCACGCATCACTGCGGACAGCTGTAAAGACGCCTCACCTATCGCAAA
GAATGGCAAGATGGTTTTCCTTTTTCGCTGAGTACAACTTTGTTGTGCATTATAAGCCCGGCAAGTCAAACATTCTTGCCGATACACTGTCAAGACGTCC
GGATTATGATCCGAAGAGCAAGAGTGACGACACGAACGGAGCGTGTCGACTCTGTGAAGACGTCAACACGATTGCTACGGGAGTGACAAGCAC