Description :
From Genome Similarity Track
Location :
Scaffold_233:30- 1114
Sequence
1084 bases(100 bases per row)
TTCTCGAGTACCTTATCGACGTTTCTGGTGACGAATAAATGAGCTGTCCAGCGCGCTTGCTTCTTCTAACCCAGATTGGTTCTAAGTGGGACGTGCGTGT
GGTGCGAGGAATTTTCGTTGGGGGCTTTTAATGGGTTACAGTCAGCAAGAGTGTGGACCGATAGAAAACCGACGTCGGCGAACCTTTGGTTGGCGAATCC
AAGGTTGGAGACGCCAAGGTCATCGAAGCTAGGTTGGCAAAGCTTTGGTAGGAAAAGCTAGGTCGGCGAATCTTAGGTAGGCAAGAAGACGCCTGCAGCC
AGCTGGGGGGTGATAGAAGATTTCAAATCCGTTTCATTAGGTATATGTAAAGAGAAAATGGTAAGAACGAATGAGAGCCACATAAAACGGCTCCACGATA
TAGCACAAGAGATACAACAATACAGTGCAGAATTTCTAAGTCCAAGACACGAGTACACTATTCCGGTTTGTCCATTCGAGAACTATGTAACGCCTGGCAT
CGAACCTCGAGGGGACTAGCTTGTATAGATTTCGAGGAATTGTTTCGGCTAAATCCACAACTGAACCCGAATGGGCGAATCACGAAGGGATATTACCCTA
ACGTACTAGCCATTCCTCCGTACTAACTAGACGGTTTTTGGGTTTGAGAAGCAGAAGAAGCAGAGCCAAACAAGGAATCATTAGCACTTTTTATCCATTG
GCTTCTGTTCCACATACAATACTCAGGTCAAAAATCCAGACCTTTCATGGGCGATCCGCAGCCTTGAGACCGCAGCAGCTCAATTATCTGCAAGTGGCGT
GTCCAGATCGCCAGATCCAGTGCCGTATAGCCATCCTGAAAATAGTTGTAGTAATCATATAATCGGTTGTATCAGAATCAGATATGTATACATTATATAA
GTATGCATTGTCCCGTCGTAAATCCGTAAGGGCGAGCACGTCGGCCCCGTACTGTACTAGCATCATAGCAATCTGGGTATTTTGTGCGAAGAGGCTGTAT
TGATACAAATTTGACTAGCGACCATACGATATGCGTTGGTATTTCTTAATCTATTTTTACCCTTTCCCATTTGCTTGTAGTCGA