Description :
From Genome Similarity Track
Location :
Scaffold_4096:30- 1080
Sequence
1050 bases(100 bases per row)
TTTGTGGAGACTCAAATCTCATGATCCGCCAACTCCGTGGGGAGATGGACTGCAAGTCACCCGACCTCAAGCTGCTCCATGAGAAAGCGAGGAAGATACT
GAGTCCATGGAGTCACCCAGAGATGATCCACGTCAAACGCGGCTAGAACCAGCCGGCAGATTTGCTGGCCGAACAAGCGCTTCAACGACACGAATGCGTG
ATTGTGAGGACGACGGAAGAAATCTCGGATCTCCAAACGCTGAATCGTTTCGACGAAGTTGTTCACATTACTGAAAACGCTCACGAGAGAGCAAAATCGG
AGTCTGGCAAGTTGGACGAGATCGAGTGGAAAGGGGGAAAGGACCAGGTCGAGATGGCTATGCCAGACTTGAAGCCAGAAGTGATGCCGGTGACGACACA
ATTGGGGGTGTTTCCGCAGAGTTCCACTTGTCTTCGAGGAGTTCAGGAAATCAGACTCGATCGCATCCGTCAAGCGCAAGACGAGGAGAAATGGATCATT
ACCTTAAAGAGCTTTTTGCAGGGAGATCTCGAAACGATCTCCAAATCTGAGGCTAAGCAGAATGCTAAGCTAGCCGATCAGTTCGAAGTCGATCGTTGAG
GGCTGATGTTGTAGTGCGCCATGATCCCCAAGGACAAAGAAGACCCTGAGTGGTCGCTGAGGCTCGTGGTACCTACGACATTGCAAGACGACCTGTTGCA
CCATTGCCATTCGAGTCTCGAAGGAGGTCACCAAGGAATTGGCAAAACGTACCAGCATCTACGACAGTTTTTCTATTGGCGATTGATGTACCGCAGTGCC
CAGAAATACATCGGCGGATGTGTGGACTGTGATGTGGAAAGGGGGGATCAACAATACGGGAAGAAACACCGGGCAACATAACCGCGCGATATCCGTTCCA
GGTGATTGCGATGGATCACATCCCGACGCTTCCAGAACCACATAAAGGCAACACAGTGCTACTCGTGTGGGTGAATCTATTTTCAGGTTTTGTTGTCGCA
AAAGCAAATTCGTCACGTACCGCGCAGACTGTCGCCGGGGCATGTGAGGA